ID: 939569929

View in Genome Browser
Species Human (GRCh38)
Location 2:143829162-143829184
Sequence ATTTCCATACAGATGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939569922_939569929 23 Left 939569922 2:143829116-143829138 CCACACCCTCAAATGAAGTCTGC No data
Right 939569929 2:143829162-143829184 ATTTCCATACAGATGGAAAAGGG No data
939569923_939569929 18 Left 939569923 2:143829121-143829143 CCCTCAAATGAAGTCTGCAAATA No data
Right 939569929 2:143829162-143829184 ATTTCCATACAGATGGAAAAGGG No data
939569924_939569929 17 Left 939569924 2:143829122-143829144 CCTCAAATGAAGTCTGCAAATAG No data
Right 939569929 2:143829162-143829184 ATTTCCATACAGATGGAAAAGGG No data
939569921_939569929 24 Left 939569921 2:143829115-143829137 CCCACACCCTCAAATGAAGTCTG No data
Right 939569929 2:143829162-143829184 ATTTCCATACAGATGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939569929 Original CRISPR ATTTCCATACAGATGGAAAA GGG Intergenic
No off target data available for this crispr