ID: 939571432

View in Genome Browser
Species Human (GRCh38)
Location 2:143845025-143845047
Sequence ACAGGCTATAAAGGTCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939571429_939571432 17 Left 939571429 2:143844985-143845007 CCTCAAGCTACTCAAATAATAGC No data
Right 939571432 2:143845025-143845047 ACAGGCTATAAAGGTCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939571432 Original CRISPR ACAGGCTATAAAGGTCAAAA TGG Intergenic
No off target data available for this crispr