ID: 939573570

View in Genome Browser
Species Human (GRCh38)
Location 2:143869090-143869112
Sequence GCAGACTGGCCAAGAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939573567_939573570 4 Left 939573567 2:143869063-143869085 CCAGAACACTCTAGGGGTGGAGA No data
Right 939573570 2:143869090-143869112 GCAGACTGGCCAAGAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939573570 Original CRISPR GCAGACTGGCCAAGAAACAC AGG Intergenic
No off target data available for this crispr