ID: 939575723

View in Genome Browser
Species Human (GRCh38)
Location 2:143892722-143892744
Sequence CAGTGTCATCAGTGGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939575719_939575723 7 Left 939575719 2:143892692-143892714 CCGCTGCTAGCAACGTGGAGACA No data
Right 939575723 2:143892722-143892744 CAGTGTCATCAGTGGGAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939575723 Original CRISPR CAGTGTCATCAGTGGGAAAA GGG Intergenic
No off target data available for this crispr