ID: 939575843

View in Genome Browser
Species Human (GRCh38)
Location 2:143893608-143893630
Sequence AAACTAGGGCGGGCTTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939575843_939575851 1 Left 939575843 2:143893608-143893630 CCTTTCCAAGCCCGCCCTAGTTT No data
Right 939575851 2:143893632-143893654 TGGTGAAAGCACACAGATTTGGG No data
939575843_939575853 12 Left 939575843 2:143893608-143893630 CCTTTCCAAGCCCGCCCTAGTTT No data
Right 939575853 2:143893643-143893665 CACAGATTTGGGGTGAATTTTGG No data
939575843_939575852 2 Left 939575843 2:143893608-143893630 CCTTTCCAAGCCCGCCCTAGTTT No data
Right 939575852 2:143893633-143893655 GGTGAAAGCACACAGATTTGGGG No data
939575843_939575850 0 Left 939575843 2:143893608-143893630 CCTTTCCAAGCCCGCCCTAGTTT No data
Right 939575850 2:143893631-143893653 TTGGTGAAAGCACACAGATTTGG No data
939575843_939575854 18 Left 939575843 2:143893608-143893630 CCTTTCCAAGCCCGCCCTAGTTT No data
Right 939575854 2:143893649-143893671 TTTGGGGTGAATTTTGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939575843 Original CRISPR AAACTAGGGCGGGCTTGGAA AGG (reversed) Intergenic
No off target data available for this crispr