ID: 939575848

View in Genome Browser
Species Human (GRCh38)
Location 2:143893622-143893644
Sequence TGTGCTTTCACCAAAAACTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939575848_939575853 -2 Left 939575848 2:143893622-143893644 CCCTAGTTTTTGGTGAAAGCACA No data
Right 939575853 2:143893643-143893665 CACAGATTTGGGGTGAATTTTGG No data
939575848_939575855 29 Left 939575848 2:143893622-143893644 CCCTAGTTTTTGGTGAAAGCACA No data
Right 939575855 2:143893674-143893696 TTTACTGACTCTTCAGATCTTGG No data
939575848_939575854 4 Left 939575848 2:143893622-143893644 CCCTAGTTTTTGGTGAAAGCACA No data
Right 939575854 2:143893649-143893671 TTTGGGGTGAATTTTGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939575848 Original CRISPR TGTGCTTTCACCAAAAACTA GGG (reversed) Intergenic
No off target data available for this crispr