ID: 939575851

View in Genome Browser
Species Human (GRCh38)
Location 2:143893632-143893654
Sequence TGGTGAAAGCACACAGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939575845_939575851 -4 Left 939575845 2:143893613-143893635 CCAAGCCCGCCCTAGTTTTTGGT No data
Right 939575851 2:143893632-143893654 TGGTGAAAGCACACAGATTTGGG No data
939575841_939575851 26 Left 939575841 2:143893583-143893605 CCGCTCCAGCGAGGGTGCAGAGT No data
Right 939575851 2:143893632-143893654 TGGTGAAAGCACACAGATTTGGG No data
939575842_939575851 21 Left 939575842 2:143893588-143893610 CCAGCGAGGGTGCAGAGTGACCT No data
Right 939575851 2:143893632-143893654 TGGTGAAAGCACACAGATTTGGG No data
939575846_939575851 -9 Left 939575846 2:143893618-143893640 CCCGCCCTAGTTTTTGGTGAAAG No data
Right 939575851 2:143893632-143893654 TGGTGAAAGCACACAGATTTGGG No data
939575840_939575851 29 Left 939575840 2:143893580-143893602 CCTCCGCTCCAGCGAGGGTGCAG No data
Right 939575851 2:143893632-143893654 TGGTGAAAGCACACAGATTTGGG No data
939575843_939575851 1 Left 939575843 2:143893608-143893630 CCTTTCCAAGCCCGCCCTAGTTT No data
Right 939575851 2:143893632-143893654 TGGTGAAAGCACACAGATTTGGG No data
939575847_939575851 -10 Left 939575847 2:143893619-143893641 CCGCCCTAGTTTTTGGTGAAAGC No data
Right 939575851 2:143893632-143893654 TGGTGAAAGCACACAGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939575851 Original CRISPR TGGTGAAAGCACACAGATTT GGG Intergenic
No off target data available for this crispr