ID: 939575854

View in Genome Browser
Species Human (GRCh38)
Location 2:143893649-143893671
Sequence TTTGGGGTGAATTTTGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939575847_939575854 7 Left 939575847 2:143893619-143893641 CCGCCCTAGTTTTTGGTGAAAGC No data
Right 939575854 2:143893649-143893671 TTTGGGGTGAATTTTGGCTCTGG No data
939575846_939575854 8 Left 939575846 2:143893618-143893640 CCCGCCCTAGTTTTTGGTGAAAG No data
Right 939575854 2:143893649-143893671 TTTGGGGTGAATTTTGGCTCTGG No data
939575845_939575854 13 Left 939575845 2:143893613-143893635 CCAAGCCCGCCCTAGTTTTTGGT No data
Right 939575854 2:143893649-143893671 TTTGGGGTGAATTTTGGCTCTGG No data
939575843_939575854 18 Left 939575843 2:143893608-143893630 CCTTTCCAAGCCCGCCCTAGTTT No data
Right 939575854 2:143893649-143893671 TTTGGGGTGAATTTTGGCTCTGG No data
939575848_939575854 4 Left 939575848 2:143893622-143893644 CCCTAGTTTTTGGTGAAAGCACA No data
Right 939575854 2:143893649-143893671 TTTGGGGTGAATTTTGGCTCTGG No data
939575849_939575854 3 Left 939575849 2:143893623-143893645 CCTAGTTTTTGGTGAAAGCACAC No data
Right 939575854 2:143893649-143893671 TTTGGGGTGAATTTTGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939575854 Original CRISPR TTTGGGGTGAATTTTGGCTC TGG Intergenic
No off target data available for this crispr