ID: 939580235

View in Genome Browser
Species Human (GRCh38)
Location 2:143937911-143937933
Sequence GGGGAACCTCTTACAAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939580227_939580235 16 Left 939580227 2:143937872-143937894 CCATCGTGTAGGACAGTTTGCTG 0: 1
1: 0
2: 0
3: 8
4: 194
Right 939580235 2:143937911-143937933 GGGGAACCTCTTACAAAAAAGGG 0: 1
1: 0
2: 0
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939580235 Original CRISPR GGGGAACCTCTTACAAAAAA GGG Intergenic
907975060 1:59423563-59423585 GGGGATCCTCTTTCAAATAAAGG + Intronic
908867876 1:68572238-68572260 GGGGAACCTACTACAATAACTGG + Intergenic
911391742 1:97253787-97253809 GGGGAAACTTTTAAAAATAAAGG - Intronic
921693707 1:218182850-218182872 GGGGAACTTCTTACAAATACTGG - Intergenic
923361228 1:233213340-233213362 TGGGAACCTCAAACAGAAAAAGG + Intronic
924038259 1:239957616-239957638 GGGTACCATCTTAAAAAAAATGG - Intergenic
924285335 1:242480262-242480284 GGGGTAGCCCTTTCAAAAAATGG + Intronic
1065271637 10:24039133-24039155 GGAGAACCTCTAAAAAAAATTGG - Intronic
1068510577 10:57960431-57960453 GAGGAACATCTTACAAAGAAGGG + Intergenic
1069154453 10:65009414-65009436 AGGGAATTTCTTACAAAAATTGG - Intergenic
1070499291 10:77055410-77055432 GAGGTAACTCTTAGAAAAAATGG + Intronic
1073733090 10:106314301-106314323 GAGGAAGCTCTTACAAAAGGAGG + Intergenic
1075151691 10:119938465-119938487 GGAGAACCCCTCACAAAAAGTGG - Intronic
1077275472 11:1704856-1704878 GGAGAACCGTTTCCAAAAAATGG + Intergenic
1078035658 11:7802250-7802272 TGGGACCCTCTCACAAAACATGG - Intergenic
1082012461 11:47459357-47459379 GGGGAACCTCTAACAGCACAGGG + Intergenic
1082293290 11:50407881-50407903 TGGGAGCTTCTTTCAAAAAATGG + Intergenic
1087436563 11:98126274-98126296 GGGTAACCTCTGACAACAAGTGG - Intergenic
1088686285 11:112286979-112287001 GGAGACCCTCGTACAAAGAAAGG - Intergenic
1088863943 11:113828332-113828354 GTGCATCCTCTTACAAAAGAGGG - Intronic
1090129103 11:124120880-124120902 GGGGAACTTCTTAGAAAAACAGG - Intronic
1092858981 12:12703011-12703033 CTGGAACATCATACAAAAAAAGG - Intergenic
1093737330 12:22636150-22636172 TGGGACCCTCTCTCAAAAAAAGG + Intronic
1097476284 12:60059492-60059514 GGAGAAGCTCTAACAAAAAGAGG - Intergenic
1102215195 12:111156277-111156299 GGGGAACATCTTAGAGCAAAAGG - Intronic
1108164768 13:47680743-47680765 GGGGGACATCTTACTAAATAGGG - Intergenic
1108583979 13:51851871-51851893 AGGGAACCACTTACATAAACTGG - Intergenic
1108772611 13:53722870-53722892 AGGCAACCTTTTACAAACAAGGG + Intergenic
1110247115 13:73339361-73339383 GTGGAAGCTTTTACACAAAATGG - Intergenic
1110260951 13:73484711-73484733 GGAGAACCTCTTAGAAATATGGG - Intergenic
1114907015 14:27142159-27142181 TAGGAACCTCTCACAATAAAAGG - Intergenic
1120327562 14:83050166-83050188 GGGGCACCTCTCACAAATAAAGG - Intergenic
1120665347 14:87300045-87300067 GGGGTCCCTCTCACAACAAATGG - Intergenic
1122642978 14:103172102-103172124 GGGCAACCTCTTTCAGGAAATGG + Intergenic
1123551995 15:21389861-21389883 GGGGAAACTCTGGGAAAAAATGG + Intergenic
1124080016 15:26484888-26484910 GGATAACATCTTAAAAAAAAGGG + Intergenic
1124533217 15:30523728-30523750 GGAGAACCTCTGTCAAAAAGAGG - Intergenic
1124765440 15:32483916-32483938 GGAGAACCTCTGTCAAAAAGAGG + Intergenic
1126248943 15:46543894-46543916 GGGAAACCTCTTTCAGGAAATGG + Intergenic
1126554889 15:49975350-49975372 GGGGGATCCCTTACATAAAATGG + Intronic
1127239717 15:57099302-57099324 GTGGAACCTCTTTCAAACTAAGG - Intronic
1127920467 15:63490483-63490505 GGGGAAGCCCTCAAAAAAAAGGG + Intergenic
1128179407 15:65588328-65588350 GGGGAACCCCTGACAGAAATAGG + Intronic
1129499124 15:76019003-76019025 GGGGAATCTCTAAAAAAAAAAGG - Intronic
1135782459 16:25316094-25316116 GGGGCACCTTTTTCAATAAATGG + Intergenic
1136650151 16:31662229-31662251 GGGCAACCTCTTTCAGGAAATGG + Intergenic
1137434543 16:48444913-48444935 GGTGACCCTCTCTCAAAAAAAGG - Intronic
1139069615 16:63364321-63364343 GAGGAACCCCATACAAAATAGGG - Intergenic
1144368121 17:14564321-14564343 GGGGAACATTTTGAAAAAAATGG + Intergenic
1147474078 17:40693307-40693329 GGGGTACCTCTCACAGAAATAGG + Intergenic
1156989814 18:43395495-43395517 GAGAAACCTCTTGCAAAGAAGGG - Intergenic
1158433301 18:57412317-57412339 GGTAAAACTCTTACAAAAATAGG + Intergenic
1160952896 19:1676027-1676049 GGGGAACCGTTTACAAGAAGCGG - Intergenic
1162969522 19:14171812-14171834 GGGGAACCTATTTAACAAAAAGG + Intronic
1163166493 19:15501701-15501723 GGGGAAGCCCTCAGAAAAAATGG + Intergenic
1164425271 19:28135939-28135961 GGGAAACATCTTGCAAAGAAAGG + Intergenic
1164507200 19:28870136-28870158 GGGGTCCCTCTCACAGAAAATGG - Intergenic
1164787125 19:30942507-30942529 GGGGAACCTCCGACAAAAATTGG - Intergenic
926059870 2:9798525-9798547 TGGGAAACTCTTCCAAAGAAAGG + Intergenic
927109672 2:19855449-19855471 TGGGAACATCTTAAAAAAAAGGG - Intergenic
928488307 2:31754799-31754821 GGGGCATCTCTGAAAAAAAAAGG + Intergenic
929185776 2:39092452-39092474 GGGGATACTCTTAAAAATAATGG - Intronic
932205688 2:69880258-69880280 GAGTAAGCTCTTACATAAAATGG + Exonic
932668128 2:73713711-73713733 GGGGAACCACTTAATAAACAAGG - Intergenic
939446219 2:142312921-142312943 GGGGAAAGTCTTAGAAAAATAGG - Intergenic
939580235 2:143937911-143937933 GGGGAACCTCTTACAAAAAAGGG + Intergenic
939842408 2:147205483-147205505 TGGGTACCTCTGACAACAAATGG + Intergenic
940896556 2:159086603-159086625 GGGGAACCTCTGGAAATAAAGGG + Intronic
941647082 2:168052012-168052034 AGGAAACCTCTTACCAAAGAAGG + Intronic
942207198 2:173630950-173630972 TTGGCAGCTCTTACAAAAAAAGG - Intergenic
947330775 2:229027311-229027333 TGGGAACCTCTTATACACAATGG + Intronic
948870961 2:240797804-240797826 GGGGAACACCTTGGAAAAAAGGG + Exonic
1173930587 20:46814707-46814729 TGGGAAGCTCTCACAAGAAAGGG - Intergenic
1182300445 22:29334126-29334148 GGGGAACATCCTTCAGAAAAGGG + Intronic
951852527 3:27157690-27157712 GTAGAACTTCTTACAAAAACTGG - Intronic
953172564 3:40520880-40520902 GGGGAACTTTTTTCAAAAAATGG - Intergenic
954249787 3:49358600-49358622 CAGGAACCTCTGAGAAAAAACGG - Exonic
955640093 3:61073167-61073189 AGGGAACCTCTTACAAAAGCAGG - Intronic
955773068 3:62405493-62405515 TGGGAACTGCTTACATAAAATGG - Intronic
956901499 3:73721112-73721134 GGGGAACCTCTGAGAGAAAATGG - Intergenic
958057989 3:88438481-88438503 GGGGAAGCACTTACACAGAAAGG - Intergenic
963975321 3:151473831-151473853 GGGGAAGCTATTAAAAAAACAGG - Intergenic
964337467 3:155671015-155671037 AGAGAACCTTTTACAAAAACAGG + Intronic
966111946 3:176413773-176413795 TTGAAACCTCTTAGAAAAAAAGG + Intergenic
968820468 4:2846580-2846602 GAGGTATCTCTTACAGAAAAGGG + Intronic
977382465 4:96293691-96293713 GGGGAAACTCCTACATATAATGG - Intergenic
978067008 4:104417374-104417396 GAGGAACCTGTTATAACAAAAGG + Intergenic
978169378 4:105650809-105650831 GAGGAACCTCTTACATGCAATGG - Intronic
982475442 4:155844337-155844359 GTGGAAACTCCCACAAAAAAAGG - Intronic
982897954 4:160957893-160957915 TTGGAAACTCTAACAAAAAAGGG + Intergenic
983346735 4:166536245-166536267 GGGGAACCCCTGAGAAAAAGAGG - Intergenic
987583073 5:19820677-19820699 GGGGAACCCCTTCCAAATACTGG - Intronic
987994826 5:25263425-25263447 GGAGAAACTCCTACAACAAAAGG - Intergenic
988035720 5:25824870-25824892 GGTGAAACTCTGTCAAAAAAAGG - Intergenic
988106947 5:26763249-26763271 GTAGAATTTCTTACAAAAAAAGG - Intergenic
988923321 5:35963883-35963905 ATGGCACCTCTAACAAAAAATGG + Intronic
996677608 5:126194841-126194863 GGGGAAGCTCTTCAAAAAAGAGG - Intergenic
997026513 5:130069031-130069053 GGGTAACCTATTAGAAAATATGG - Intronic
999839609 5:155411155-155411177 GGGGAACATCTTACAAATGGTGG - Intergenic
1002033395 5:176447477-176447499 GGGGAATCTCATTCAACAAATGG + Intergenic
1006493631 6:34405307-34405329 AGGGAAACTATTTCAAAAAATGG + Intronic
1010038250 6:71351544-71351566 GTGGAACCAATTACAAATAAGGG + Intergenic
1010446050 6:75949661-75949683 TGTGAACCTGTTACAGAAAAGGG - Intronic
1012072323 6:94638964-94638986 GGGGAACTTGTTACAAATAGAGG + Intergenic
1021343429 7:19491468-19491490 AGAGGAACTCTTACAAAAAAGGG - Intergenic
1022155016 7:27651962-27651984 GGGGAACTCCATACAGAAAAAGG + Intronic
1023382247 7:39621056-39621078 GGTGAACAACTGACAAAAAAGGG + Intergenic
1026227403 7:68454699-68454721 GGTGAAACTGTTACAAGAAAGGG - Intergenic
1026932361 7:74230612-74230634 AGCGAGACTCTTACAAAAAAAGG - Intergenic
1030831234 7:114224694-114224716 GAAGAGCCTCTTAAAAAAAAAGG - Intronic
1032981671 7:137291221-137291243 AGGTAACTTCTTTCAAAAAATGG - Intronic
1038390235 8:27191454-27191476 GGGGGACATTTTAAAAAAAATGG + Intergenic
1039736498 8:40338275-40338297 GGGGAATCTTTTGCAAAAAGAGG + Intergenic
1040682817 8:49834309-49834331 AGGGAACCTCATATCAAAAAAGG - Intergenic
1041414035 8:57587729-57587751 GGGGAAATTCTTACAAAATCAGG - Intergenic
1042011995 8:64256917-64256939 GGGGAACCTCTTAATACAGATGG + Intergenic
1043218225 8:77622376-77622398 GGGTAAACTTTTACAAAAAGAGG + Intergenic
1050969244 9:11847374-11847396 ACGACACCTCTTACAAAAAATGG + Intergenic
1051110030 9:13625239-13625261 GGAGATCCTCTTATCAAAAATGG - Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1055800002 9:80024456-80024478 GGGGAACAACTGGCAAAAAATGG - Intergenic
1059049069 9:110902728-110902750 GGGGATCCTGCCACAAAAAAAGG + Intronic
1060424185 9:123491188-123491210 AGGGAACCTCATTCTAAAAAGGG - Intronic
1060863941 9:126979951-126979973 TGGGAAACTTTTACAAAATAGGG - Intronic
1189704149 X:43743190-43743212 GGGTCTCCTCTTACAAAGAAGGG - Intronic
1191732063 X:64347232-64347254 ATGGAACCTGTTAAAAAAAAGGG + Intronic
1193043461 X:77027837-77027859 GGGGATCCTGTCTCAAAAAAAGG - Intergenic
1195016358 X:100785542-100785564 GTGGAAACGCCTACAAAAAAAGG - Intergenic
1197780248 X:130152071-130152093 GGGAAAGCTTTTCCAAAAAAGGG + Intronic