ID: 939582789

View in Genome Browser
Species Human (GRCh38)
Location 2:143970262-143970284
Sequence ATATATTACCATCTGTTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939582789_939582794 25 Left 939582789 2:143970262-143970284 CCACCTAACAGATGGTAATATAT No data
Right 939582794 2:143970310-143970332 ATTCAAACCAGTGACCCCAGAGG No data
939582789_939582791 2 Left 939582789 2:143970262-143970284 CCACCTAACAGATGGTAATATAT No data
Right 939582791 2:143970287-143970309 CAGCCAATACCAATGTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939582789 Original CRISPR ATATATTACCATCTGTTAGG TGG (reversed) Intronic
No off target data available for this crispr