ID: 939582790

View in Genome Browser
Species Human (GRCh38)
Location 2:143970265-143970287
Sequence GAAATATATTACCATCTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939582790_939582796 29 Left 939582790 2:143970265-143970287 CCTAACAGATGGTAATATATTTC No data
Right 939582796 2:143970317-143970339 CCAGTGACCCCAGAGGTGAGAGG No data
939582790_939582794 22 Left 939582790 2:143970265-143970287 CCTAACAGATGGTAATATATTTC No data
Right 939582794 2:143970310-143970332 ATTCAAACCAGTGACCCCAGAGG No data
939582790_939582791 -1 Left 939582790 2:143970265-143970287 CCTAACAGATGGTAATATATTTC No data
Right 939582791 2:143970287-143970309 CAGCCAATACCAATGTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939582790 Original CRISPR GAAATATATTACCATCTGTT AGG (reversed) Intronic
No off target data available for this crispr