ID: 939582791

View in Genome Browser
Species Human (GRCh38)
Location 2:143970287-143970309
Sequence CAGCCAATACCAATGTGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939582790_939582791 -1 Left 939582790 2:143970265-143970287 CCTAACAGATGGTAATATATTTC No data
Right 939582791 2:143970287-143970309 CAGCCAATACCAATGTGAGCAGG No data
939582789_939582791 2 Left 939582789 2:143970262-143970284 CCACCTAACAGATGGTAATATAT No data
Right 939582791 2:143970287-143970309 CAGCCAATACCAATGTGAGCAGG No data
939582787_939582791 21 Left 939582787 2:143970243-143970265 CCAAAATGCTTTACATAGGCCAC No data
Right 939582791 2:143970287-143970309 CAGCCAATACCAATGTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939582791 Original CRISPR CAGCCAATACCAATGTGAGC AGG Intronic
No off target data available for this crispr