ID: 939582792

View in Genome Browser
Species Human (GRCh38)
Location 2:143970290-143970312
Sequence AATCCTGCTCACATTGGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939582792_939582796 4 Left 939582792 2:143970290-143970312 CCAATACCAATGTGAGCAGGATT No data
Right 939582796 2:143970317-143970339 CCAGTGACCCCAGAGGTGAGAGG No data
939582792_939582794 -3 Left 939582792 2:143970290-143970312 CCAATACCAATGTGAGCAGGATT No data
Right 939582794 2:143970310-143970332 ATTCAAACCAGTGACCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939582792 Original CRISPR AATCCTGCTCACATTGGTAT TGG (reversed) Intronic
No off target data available for this crispr