ID: 939582796

View in Genome Browser
Species Human (GRCh38)
Location 2:143970317-143970339
Sequence CCAGTGACCCCAGAGGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939582793_939582796 -2 Left 939582793 2:143970296-143970318 CCAATGTGAGCAGGATTCAAACC No data
Right 939582796 2:143970317-143970339 CCAGTGACCCCAGAGGTGAGAGG No data
939582792_939582796 4 Left 939582792 2:143970290-143970312 CCAATACCAATGTGAGCAGGATT No data
Right 939582796 2:143970317-143970339 CCAGTGACCCCAGAGGTGAGAGG No data
939582790_939582796 29 Left 939582790 2:143970265-143970287 CCTAACAGATGGTAATATATTTC No data
Right 939582796 2:143970317-143970339 CCAGTGACCCCAGAGGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939582796 Original CRISPR CCAGTGACCCCAGAGGTGAG AGG Intronic
No off target data available for this crispr