ID: 939583043

View in Genome Browser
Species Human (GRCh38)
Location 2:143973854-143973876
Sequence TTGGCTACAGCCACATATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939583041_939583043 12 Left 939583041 2:143973819-143973841 CCTAATATTCAATTATTAAAGAT No data
Right 939583043 2:143973854-143973876 TTGGCTACAGCCACATATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939583043 Original CRISPR TTGGCTACAGCCACATATCA AGG Intronic
No off target data available for this crispr