ID: 939588934

View in Genome Browser
Species Human (GRCh38)
Location 2:144039686-144039708
Sequence CTCAAACAGAAGTCAGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939588934_939588940 19 Left 939588934 2:144039686-144039708 CCTTTTCCTGACTTCTGTTTGAG No data
Right 939588940 2:144039728-144039750 GAGGTTTACAGGGACCAGAAAGG No data
939588934_939588938 8 Left 939588934 2:144039686-144039708 CCTTTTCCTGACTTCTGTTTGAG No data
Right 939588938 2:144039717-144039739 ATTTTTAAGTAGAGGTTTACAGG No data
939588934_939588941 26 Left 939588934 2:144039686-144039708 CCTTTTCCTGACTTCTGTTTGAG No data
Right 939588941 2:144039735-144039757 ACAGGGACCAGAAAGGCACAAGG No data
939588934_939588939 9 Left 939588934 2:144039686-144039708 CCTTTTCCTGACTTCTGTTTGAG No data
Right 939588939 2:144039718-144039740 TTTTTAAGTAGAGGTTTACAGGG No data
939588934_939588936 0 Left 939588934 2:144039686-144039708 CCTTTTCCTGACTTCTGTTTGAG No data
Right 939588936 2:144039709-144039731 TCACTCCTATTTTTAAGTAGAGG No data
939588934_939588942 27 Left 939588934 2:144039686-144039708 CCTTTTCCTGACTTCTGTTTGAG No data
Right 939588942 2:144039736-144039758 CAGGGACCAGAAAGGCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939588934 Original CRISPR CTCAAACAGAAGTCAGGAAA AGG (reversed) Intronic
No off target data available for this crispr