ID: 939590044

View in Genome Browser
Species Human (GRCh38)
Location 2:144053741-144053763
Sequence ATTTAGCCAAGGCCAGATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939590040_939590044 9 Left 939590040 2:144053709-144053731 CCAGCACAGCAGACCTGCTGCTT No data
Right 939590044 2:144053741-144053763 ATTTAGCCAAGGCCAGATTGAGG No data
939590037_939590044 23 Left 939590037 2:144053695-144053717 CCACTCTCCTCCTTCCAGCACAG No data
Right 939590044 2:144053741-144053763 ATTTAGCCAAGGCCAGATTGAGG No data
939590036_939590044 29 Left 939590036 2:144053689-144053711 CCAACTCCACTCTCCTCCTTCCA No data
Right 939590044 2:144053741-144053763 ATTTAGCCAAGGCCAGATTGAGG No data
939590038_939590044 16 Left 939590038 2:144053702-144053724 CCTCCTTCCAGCACAGCAGACCT No data
Right 939590044 2:144053741-144053763 ATTTAGCCAAGGCCAGATTGAGG No data
939590039_939590044 13 Left 939590039 2:144053705-144053727 CCTTCCAGCACAGCAGACCTGCT No data
Right 939590044 2:144053741-144053763 ATTTAGCCAAGGCCAGATTGAGG No data
939590042_939590044 -4 Left 939590042 2:144053722-144053744 CCTGCTGCTTCTGGACGTCATTT No data
Right 939590044 2:144053741-144053763 ATTTAGCCAAGGCCAGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939590044 Original CRISPR ATTTAGCCAAGGCCAGATTG AGG Intronic
No off target data available for this crispr