ID: 939598887 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:144163841-144163863 |
| Sequence | CAGACTACCCAGGTCTACCA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 939598882_939598887 | 6 | Left | 939598882 | 2:144163812-144163834 | CCACCTGGGTGTACCATGGACTA | No data | ||
| Right | 939598887 | 2:144163841-144163863 | CAGACTACCCAGGTCTACCATGG | No data | ||||
| 939598885_939598887 | -7 | Left | 939598885 | 2:144163825-144163847 | CCATGGACTATGAAGGCAGACTA | No data | ||
| Right | 939598887 | 2:144163841-144163863 | CAGACTACCCAGGTCTACCATGG | No data | ||||
| 939598880_939598887 | 17 | Left | 939598880 | 2:144163801-144163823 | CCAAAGGTGGGCCACCTGGGTGT | No data | ||
| Right | 939598887 | 2:144163841-144163863 | CAGACTACCCAGGTCTACCATGG | No data | ||||
| 939598883_939598887 | 3 | Left | 939598883 | 2:144163815-144163837 | CCTGGGTGTACCATGGACTATGA | No data | ||
| Right | 939598887 | 2:144163841-144163863 | CAGACTACCCAGGTCTACCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 939598887 | Original CRISPR | CAGACTACCCAGGTCTACCA TGG | Intronic | ||
| No off target data available for this crispr | |||||