ID: 939598887

View in Genome Browser
Species Human (GRCh38)
Location 2:144163841-144163863
Sequence CAGACTACCCAGGTCTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939598882_939598887 6 Left 939598882 2:144163812-144163834 CCACCTGGGTGTACCATGGACTA No data
Right 939598887 2:144163841-144163863 CAGACTACCCAGGTCTACCATGG No data
939598885_939598887 -7 Left 939598885 2:144163825-144163847 CCATGGACTATGAAGGCAGACTA No data
Right 939598887 2:144163841-144163863 CAGACTACCCAGGTCTACCATGG No data
939598880_939598887 17 Left 939598880 2:144163801-144163823 CCAAAGGTGGGCCACCTGGGTGT No data
Right 939598887 2:144163841-144163863 CAGACTACCCAGGTCTACCATGG No data
939598883_939598887 3 Left 939598883 2:144163815-144163837 CCTGGGTGTACCATGGACTATGA No data
Right 939598887 2:144163841-144163863 CAGACTACCCAGGTCTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939598887 Original CRISPR CAGACTACCCAGGTCTACCA TGG Intronic
No off target data available for this crispr