ID: 939602250

View in Genome Browser
Species Human (GRCh38)
Location 2:144207439-144207461
Sequence TAGAGGTACTGGAGGCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939602243_939602250 7 Left 939602243 2:144207409-144207431 CCTGTGGCCACTTTAGAAGCAGC No data
Right 939602250 2:144207439-144207461 TAGAGGTACTGGAGGCAAGATGG No data
939602245_939602250 0 Left 939602245 2:144207416-144207438 CCACTTTAGAAGCAGCAGATGGG No data
Right 939602250 2:144207439-144207461 TAGAGGTACTGGAGGCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939602250 Original CRISPR TAGAGGTACTGGAGGCAAGA TGG Intronic
No off target data available for this crispr