ID: 939603724

View in Genome Browser
Species Human (GRCh38)
Location 2:144226426-144226448
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939603721_939603724 -3 Left 939603721 2:144226406-144226428 CCTTCATTACTTCCAAAAGTATG No data
Right 939603724 2:144226426-144226448 ATGACCAAAAGGTCTGCTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr