ID: 939604531

View in Genome Browser
Species Human (GRCh38)
Location 2:144237643-144237665
Sequence CAACTTGTGCTGTCAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939604529_939604531 -6 Left 939604529 2:144237626-144237648 CCACAGATAAATCCGATCAACTT No data
Right 939604531 2:144237643-144237665 CAACTTGTGCTGTCAAAGAAAGG No data
939604528_939604531 26 Left 939604528 2:144237594-144237616 CCATTCTATTAAAAGAATTTCAT No data
Right 939604531 2:144237643-144237665 CAACTTGTGCTGTCAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939604531 Original CRISPR CAACTTGTGCTGTCAAAGAA AGG Intronic
No off target data available for this crispr