ID: 939615945

View in Genome Browser
Species Human (GRCh38)
Location 2:144362292-144362314
Sequence TGGATGCTTTGGGGTCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939615945_939615955 30 Left 939615945 2:144362292-144362314 CCCATCAGACCCCAAAGCATCCA No data
Right 939615955 2:144362345-144362367 GAGTCAGCACTTCATTCTCTTGG No data
939615945_939615953 8 Left 939615945 2:144362292-144362314 CCCATCAGACCCCAAAGCATCCA No data
Right 939615953 2:144362323-144362345 TGAACTGACAGAGGGTCCTGTGG No data
939615945_939615952 0 Left 939615945 2:144362292-144362314 CCCATCAGACCCCAAAGCATCCA No data
Right 939615952 2:144362315-144362337 AGTTATTCTGAACTGACAGAGGG No data
939615945_939615951 -1 Left 939615945 2:144362292-144362314 CCCATCAGACCCCAAAGCATCCA No data
Right 939615951 2:144362314-144362336 AAGTTATTCTGAACTGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939615945 Original CRISPR TGGATGCTTTGGGGTCTGAT GGG (reversed) Intergenic
No off target data available for this crispr