ID: 939618511

View in Genome Browser
Species Human (GRCh38)
Location 2:144389279-144389301
Sequence ATGTAGACGGAGTTGGAGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 1, 2: 2, 3: 8, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939618511_939618520 24 Left 939618511 2:144389279-144389301 CCCAGCTCCAACTCCGTCTACAT 0: 1
1: 1
2: 2
3: 8
4: 118
Right 939618520 2:144389326-144389348 TGTCCCTCTCTACAGCTTCCTGG 0: 1
1: 0
2: 3
3: 20
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939618511 Original CRISPR ATGTAGACGGAGTTGGAGCT GGG (reversed) Exonic
900643828 1:3699771-3699793 AGGGAGGCGGAGGTGGAGCTGGG + Intronic
902113857 1:14105291-14105313 ATGAAGACTGAGAAGGAGCTGGG + Intergenic
906788096 1:48633891-48633913 ATGTGGATGGAGTTGGAGGGTGG - Intronic
912486904 1:110035891-110035913 AAGTAGACGTAATTTGAGCTTGG + Intronic
913270845 1:117091870-117091892 ATGTGGACGGTGCTGGATCTCGG - Exonic
914951161 1:152115556-152115578 GTGGAGACAGAGGTGGAGCTGGG - Intergenic
918760255 1:188395663-188395685 GTGTATATGAAGTTGGAGCTAGG + Intergenic
918777194 1:188648845-188648867 AATTAGACAGAGTTGCAGCTAGG - Intergenic
920511301 1:206554266-206554288 ATCAAGCTGGAGTTGGAGCTGGG + Intronic
923556881 1:235008061-235008083 ATGAAGATGGAGGTGGAGATTGG - Intergenic
923674200 1:236065530-236065552 AGGAAGACGGGGTGGGAGCTGGG + Intergenic
1066498728 10:35969796-35969818 ATGTAGACGGAGATAGAGCTTGG + Intergenic
1070573980 10:77663295-77663317 ATAGAGACGGGGTGGGAGCTAGG - Intergenic
1070670825 10:78376240-78376262 ATGTAAAGGGAATTGGGGCTCGG - Intergenic
1071531126 10:86391006-86391028 AGGTAGCAGGAGGTGGAGCTGGG - Intergenic
1071821937 10:89288197-89288219 TTGTAGAAGGAGTTGGGGTTTGG - Intronic
1072289367 10:93948408-93948430 ATTTAGACTGAGGTGCAGCTTGG + Intronic
1073266429 10:102230830-102230852 ATGGAGGCGGCGATGGAGCTGGG + Exonic
1074396212 10:113099993-113100015 AGGTAGAGGGAGTGGGAACTTGG - Intronic
1077202747 11:1319820-1319842 AGCTAGAGGGAGCTGGAGCTGGG - Intergenic
1077474207 11:2778721-2778743 ATGTAGACGGACTTGCTGTTCGG - Intronic
1080795840 11:35562431-35562453 ATGGAGACTGAGTAGGGGCTGGG + Intergenic
1081127238 11:39336612-39336634 AAGTAGAAGTAGTAGGAGCTGGG - Intergenic
1082089527 11:48077965-48077987 ATTGAGACTAAGTTGGAGCTGGG + Intronic
1083281674 11:61630501-61630523 GTGGAGACGGAGGTGGAGGTGGG + Intergenic
1085253210 11:75157094-75157116 ATGAAGATGGAGATGGAGATGGG + Intronic
1085706919 11:78794716-78794738 ATGTAGAAGGAGATTGAGCCAGG + Intronic
1086367133 11:86118924-86118946 AGCCAGACGGAGTTAGAGCTAGG + Intergenic
1087216865 11:95504122-95504144 ATCTAGAAGCAGTGGGAGCTTGG + Intergenic
1087245423 11:95829985-95830007 ATGTAGAAGGAGAGGGAGTTAGG + Intronic
1089173332 11:116531306-116531328 ATGGAGATGGAGTTGGAGTTAGG + Intergenic
1094336134 12:29356332-29356354 CTTTAGACAAAGTTGGAGCTTGG - Intronic
1094438846 12:30452619-30452641 ATAAAGACGGAGGTGGAGATTGG + Intergenic
1101233394 12:102764740-102764762 ATTGAGAAGGAGGTGGAGCTAGG - Intergenic
1105601171 13:21888760-21888782 CTGTAGAAGGAGTTGGATCAAGG + Intergenic
1107040541 13:35943200-35943222 ATGAAGATGGAGGTGGAGATTGG + Intronic
1107889131 13:44898775-44898797 TTCTAGAAGGAGGTGGAGCTTGG - Intergenic
1117357781 14:54942543-54942565 TTGGAGTCGGAGTTGGGGCTTGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1123049293 14:105532851-105532873 GTGTGGACGGAGATGCAGCTGGG + Intergenic
1124806537 15:32889522-32889544 GTCTAGAGGGAGTTGGAGATAGG - Intronic
1129542422 15:76361475-76361497 TGGTAGATTGAGTTGGAGCTTGG - Intronic
1134135803 16:11675637-11675659 ATGAACACTGAGTTGGGGCTGGG + Intronic
1138498772 16:57425541-57425563 ATGTGGACCGAGATGGGGCTGGG - Intergenic
1138531475 16:57636701-57636723 ATGAAGACTGAGACGGAGCTGGG - Intronic
1139233472 16:65309650-65309672 ATGTTGATGGAGTGGGAGGTGGG - Intergenic
1143510595 17:7393442-7393464 AAGTAGAAGGAGTGGGAGGTTGG - Intronic
1146564492 17:33900728-33900750 ATGTTGAAGAAGTTGGAGGTGGG + Intronic
1150634463 17:66903291-66903313 ATGGAGATGCAGTTGGAGCAGGG + Intergenic
1151442122 17:74136176-74136198 GTGTGGACAGGGTTGGAGCTGGG + Intergenic
1152261124 17:79267844-79267866 AGGTAGAAGGAGGAGGAGCTAGG + Intronic
1152585787 17:81188897-81188919 GTGTAGACGGAGGTGGAGGGAGG + Intergenic
1152759439 17:82100320-82100342 ATCCAGACGGAGTTGGGGATGGG - Intergenic
1154233311 18:12578469-12578491 ATTTATATGAAGTTGGAGCTGGG + Intronic
1158246501 18:55438448-55438470 ATGTAGAGTGAGTTGCAGTTTGG - Intronic
1158576593 18:58643861-58643883 TTGTAGAAGGAGTTGGGGTTTGG + Intergenic
1160135990 18:76272356-76272378 TTGGAGACGGAGGTGGAGATAGG - Intergenic
1160197856 18:76771638-76771660 AGGAAGACGGAATTGGAGCAGGG + Intergenic
1161942111 19:7411725-7411747 ATGAGGACAGAGTTGCAGCTTGG - Intronic
1161981837 19:7633977-7633999 AAGGAGACAGAGCTGGAGCTAGG - Intronic
1163844167 19:19629014-19629036 ACGTAAAGGCAGTTGGAGCTGGG - Intergenic
1164715199 19:30385756-30385778 ATGGAGGCGGAGTTGCACCTGGG - Intronic
1168284348 19:55322983-55323005 AGGAGGAAGGAGTTGGAGCTTGG - Intronic
1168327010 19:55543647-55543669 ATATAGACTGAGTTGGAGATGGG - Intronic
929236484 2:39610545-39610567 GGGTAGAGGGAGTTGGAGATGGG + Intergenic
931474237 2:62571341-62571363 CTGGAGATGGAGTTGGAGGTGGG - Intergenic
935658802 2:105447960-105447982 ATGTGGACTGTGTTGGAGCCTGG + Intergenic
936790563 2:116146032-116146054 AAGGAGACAGAATTGGAGCTAGG - Intergenic
939618511 2:144389279-144389301 ATGTAGACGGAGTTGGAGCTGGG - Exonic
943061766 2:183047380-183047402 TTGTAGAAGGAGTTGGGGTTTGG - Intergenic
943090729 2:183371769-183371791 CTGTAGACAGAGTTGGTGCAGGG - Intergenic
945858346 2:215093240-215093262 TTGTAGAAGGGGTTGGAGTTTGG - Intronic
948527922 2:238584528-238584550 GTGTAGAGGGGGTTGGAGCTGGG + Intergenic
949048569 2:241884364-241884386 CTGTAGATGGAGTTGGGTCTTGG + Intergenic
1170767656 20:19304543-19304565 ATGTACAAGGAGGTGGAGCCAGG - Intronic
1173211643 20:41038158-41038180 ATGTAGAGGGGGTTGGAGGCCGG - Intronic
1178383527 21:32131380-32131402 ATGTTGAAGGCGTTGGAGCCGGG - Intergenic
1178579678 21:33827887-33827909 ATGTAAGCCCAGTTGGAGCTGGG - Intronic
1182033587 22:27180165-27180187 TTGTGGACTGAGTTAGAGCTAGG - Intergenic
1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG + Exonic
1182709530 22:32311884-32311906 ATGTCCAGGGAGTTGGAGCCTGG + Intergenic
1183271610 22:36865787-36865809 CTGGAGATGGGGTTGGAGCTTGG - Intronic
949826845 3:8174565-8174587 ATGTAGCCAGAGTTGGAGGTGGG - Intergenic
952091019 3:29886356-29886378 ATGTAGTCCGAGGTAGAGCTGGG + Intronic
953241302 3:41151710-41151732 AGGTAGGCAGAGTGGGAGCTTGG - Intergenic
956723769 3:72140231-72140253 ATGTAGAATCAGTGGGAGCTTGG + Intergenic
960858414 3:122126608-122126630 ATGTAGGAGGAGTTGTAGGTTGG + Intergenic
963111639 3:141693513-141693535 TTGTAGAAGGAGTTGGGGTTTGG + Intergenic
964266666 3:154904688-154904710 ATTTAGAGGGAGTTGGAGCTGGG - Intergenic
965803332 3:172516655-172516677 ATGTAGTTGGAGGTGAAGCTGGG + Intronic
968473241 4:791462-791484 AAGTGGACAGAGGTGGAGCTGGG - Intronic
968676244 4:1882086-1882108 CTGTAGATTGAGTTGGTGCTGGG + Intronic
969341347 4:6543658-6543680 ATGGAGACGGAGAAGCAGCTAGG + Intronic
969692452 4:8711109-8711131 ATGTGGACAGATGTGGAGCTTGG + Intergenic
970469267 4:16360516-16360538 ATGTAGACAGAGTTGGAGCTGGG - Intergenic
972569019 4:40294193-40294215 ATGGAGATGGAGATGGAGGTGGG - Intergenic
974437602 4:61876610-61876632 AAGTAAACGGAGTTGGGCCTGGG + Intronic
974570606 4:63642460-63642482 ATGTAGTTGGAGTTGGGCCTTGG + Intergenic
976739736 4:88345816-88345838 TTGTAGAAGGAGTTGGGGTTTGG + Intergenic
982727602 4:158921860-158921882 ATGTAGAAGGAATGGGAGCCAGG - Intronic
984590060 4:181607115-181607137 AAGTAGACAGAGTTGGAATTTGG + Intergenic
989688704 5:44116776-44116798 TTGTAGAAGGAGTTGGGGCTTGG + Intergenic
1001006546 5:168056103-168056125 ATGAAGAAGGACTTGAAGCTGGG - Intronic
1001265407 5:170270721-170270743 ATGTACATGGAGTTGGAGTTGGG + Exonic
1011278268 6:85650928-85650950 ATGAGGAGGGAGTTAGAGCTGGG + Intergenic
1015439204 6:133228393-133228415 AGGTAGAAGGAGCTGGAGGTAGG - Intergenic
1019162076 6:170075646-170075668 ATGTGGCTGGATTTGGAGCTAGG - Intergenic
1019434427 7:1014867-1014889 CTGTAGACAGAATTGGTGCTCGG - Intronic
1020378439 7:7514760-7514782 CTGTGGAAGGAGTTGGAGGTGGG - Intronic
1021514070 7:21463701-21463723 TTGAAGACAGAGTTTGAGCTGGG + Intronic
1026361451 7:69604599-69604621 ATGGGGAAGGAGTTGGAGCTAGG + Intronic
1028017521 7:85734654-85734676 TTGTAGAGGGAGTGGGAGCTGGG + Intergenic
1030676923 7:112394043-112394065 ATGTAGAGGGAGCTGAAGGTGGG - Intergenic
1031313208 7:120225667-120225689 TTGTAGACATAGTTGGACCTAGG - Intergenic
1031704408 7:124962855-124962877 TTGTAGAAGGAGTTGGGGTTTGG + Intergenic
1031850263 7:126854549-126854571 ATGTAGAAGCAGCTGGTGCTGGG + Intronic
1036408871 8:8479813-8479835 ATGTAGCTGGATTTGGAGCCAGG + Intergenic
1043824832 8:84913623-84913645 ATGTAGAAGGAATTGGAAATTGG - Intronic
1049568504 8:143356321-143356343 GTGTAGAAGGAGCTGGAGTTAGG - Intronic
1053078320 9:35153736-35153758 TTGTAGAAGGGGTTGGAGTTTGG + Intergenic
1056401504 9:86232084-86232106 ATGTATAGAGAGTTGGAGATTGG - Intronic
1059763462 9:117361372-117361394 ATGAGGGTGGAGTTGGAGCTAGG - Intronic
1060106337 9:120875880-120875902 ATGTGGAGGGACTTGGAGCCAGG - Intronic
1062322893 9:135998978-135999000 ATGACCACAGAGTTGGAGCTTGG - Intergenic
1186096161 X:6104831-6104853 ATGTATATGGAGTTAGAGGTAGG + Intronic
1186432758 X:9518906-9518928 ATGTAGGAGGTGGTGGAGCTGGG + Intronic
1189203963 X:39221833-39221855 AGGTATATGGAGCTGGAGCTTGG + Intergenic
1195307342 X:103597046-103597068 GTGTAGAGGGTGATGGAGCTAGG + Intergenic
1196112167 X:111958280-111958302 ATGTAGATGGAAATGAAGCTAGG - Intronic
1196652220 X:118179587-118179609 ATATAGAAAGAGATGGAGCTGGG + Intergenic