ID: 939621807

View in Genome Browser
Species Human (GRCh38)
Location 2:144429565-144429587
Sequence CGGCAGTTACATCTTAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939621807_939621811 24 Left 939621807 2:144429565-144429587 CCCTTCCTAAGATGTAACTGCCG 0: 1
1: 0
2: 1
3: 5
4: 54
Right 939621811 2:144429612-144429634 TCATAATCTGTCACCAGCTTTGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939621807 Original CRISPR CGGCAGTTACATCTTAGGAA GGG (reversed) Intronic
905171191 1:36110845-36110867 GGTCAGTTTCATCTCAGGAATGG - Intronic
918539050 1:185607227-185607249 CTCAAGTTACATATTAGGAATGG + Intergenic
919281033 1:195488869-195488891 TGGCAGTTATATTTTAGGAATGG + Intergenic
919659210 1:200226990-200227012 GGGCAAATACATCTTAGAAAGGG - Intergenic
922671485 1:227511336-227511358 CAGCAGTTACTTCTGGGGAAGGG - Intergenic
1073199224 10:101721432-101721454 CGGCATTTTCTTCTTAGGCAAGG - Intergenic
1080186076 11:29488860-29488882 TGGCAGTTACCTCTGAGAAATGG + Intergenic
1091177342 11:133573344-133573366 CCCCAGTTAGATGTTAGGAATGG - Intergenic
1101432148 12:104635419-104635441 CGGCAATTACATCTTCTTAAGGG - Intronic
1105443247 13:20432378-20432400 CAGCAGATGCATCTTTGGAATGG + Intronic
1107062122 13:36170650-36170672 CAGCAGTTGCATCGTAGGAAGGG + Exonic
1113718738 13:112534863-112534885 CTGGAGTTAGATCATAGGAATGG - Intronic
1118750400 14:68803447-68803469 CGGCCATTACATTTTTGGAAAGG - Intergenic
1119047376 14:71330956-71330978 TGGCAGTTACTTCTTAGATACGG - Intronic
1126140803 15:45436968-45436990 AGGCTCTTACAGCTTAGGAAAGG + Intronic
1133146593 16:3791594-3791616 TGGCAGTGACGTCTTAGGGAGGG - Intronic
1133622731 16:7542083-7542105 CAGCAGTTCCCTGTTAGGAATGG + Intronic
1136117824 16:28106486-28106508 CATCAGTCACATCTGAGGAAAGG + Exonic
1164545246 19:29155357-29155379 CAGCAGTTACCTCTTAGCAGAGG - Intergenic
1165544868 19:36526924-36526946 AGGCACTTACATCTTAGAGAAGG - Intronic
1168073749 19:53967256-53967278 CTGCTGTTTCATCTTATGAATGG - Intronic
931851088 2:66251420-66251442 CAGCTGCTGCATCTTAGGAAAGG - Intergenic
939621807 2:144429565-144429587 CGGCAGTTACATCTTAGGAAGGG - Intronic
941434597 2:165453665-165453687 ATGCAGTGCCATCTTAGGAAAGG + Intergenic
941771331 2:169349110-169349132 TGCCATTTACATCTTAGGGAAGG + Intronic
941892814 2:170599274-170599296 AGGCAGTTACATCAAAGGAGAGG + Intronic
942695023 2:178632369-178632391 TGGCAGTTACATCTTTGAGAGGG + Exonic
944847550 2:203683934-203683956 AGGCAGTTTCAGCTTTGGAAAGG - Intergenic
948538884 2:238670970-238670992 TGGCAGTTACCTTTGAGGAAGGG - Intergenic
1170092209 20:12602999-12603021 CTGAAGTCACTTCTTAGGAAAGG + Intergenic
1177838075 21:26207734-26207756 AGGCTGTTACTGCTTAGGAATGG - Intergenic
1181952188 22:26562552-26562574 CAGCAGTTACATCTTAGAAAAGG - Intronic
1183452179 22:37902762-37902784 CTGCAGCTACTTCTTAGGAGGGG + Intergenic
949709380 3:6856964-6856986 AGGCAGTGACATCTAGGGAAAGG - Intronic
950344507 3:12280215-12280237 GGGCATTTACATCTTAGTAAGGG + Intergenic
956266571 3:67403283-67403305 CGGGAGTTGCATCTTGGGATGGG - Intronic
973914155 4:55616402-55616424 TGTCAGTTACATCCTGGGAATGG + Intronic
981309178 4:143279658-143279680 CTTCATTTACATCTTAGAAATGG - Intergenic
986325717 5:6672140-6672162 GGGCAGTTACTTCTTTGGAGTGG + Intergenic
989625421 5:43425073-43425095 CTGCAGTTTCATCTTAGGTTTGG + Intergenic
997399443 5:133591175-133591197 CTGCAGGGACATCCTAGGAATGG + Intronic
1002553286 5:180014350-180014372 CGGCAGCTTCAGCTTATGAAAGG - Intronic
1003361947 6:5435284-5435306 CTGTAGTTACCTCTAAGGAAGGG + Intronic
1003616241 6:7657688-7657710 CGGCAGCTACAGCCTAAGAAAGG - Intergenic
1003908861 6:10725666-10725688 GGGCACTTCCATCTAAGGAAAGG - Intronic
1003911922 6:10750894-10750916 GGGCACTTCCATCTAAGGAAAGG - Intronic
1006749624 6:36368744-36368766 AGGCAGTTACCTCTTATGGATGG - Intronic
1007957849 6:45933464-45933486 CTGCAGTTACAACTGATGAAGGG + Intronic
1011637320 6:89386277-89386299 AGGCAGATACATTTTAGGAAGGG - Intronic
1013118904 6:107124091-107124113 CGGCTGTTATCTCTTATGAAGGG + Intergenic
1019784253 7:2964402-2964424 CAGCAGTTTCAGTTTAGGAAGGG - Intronic
1020560056 7:9719522-9719544 TGGGAGTTACAGTTTAGGAATGG + Intergenic
1021692664 7:23246097-23246119 GGACAACTACATCTTAGGAAAGG + Intronic
1023899283 7:44462852-44462874 AGGCAATTACATTTTAGTAAAGG - Intronic
1047003189 8:120593641-120593663 CGGTATTTGCATCTTAAGAAGGG + Intronic
1048935427 8:139351303-139351325 CTGCAGTTATATTTTAGGATGGG + Intergenic
1050609794 9:7339850-7339872 TGGCAGTTACTCCTTAGGCAAGG - Intergenic
1062516776 9:136940813-136940835 TAGCAGTTACGCCTTAGGAAGGG - Exonic
1187094293 X:16130094-16130116 AGGCAGAAACATCTTAGGAAGGG - Intronic
1189910131 X:45802492-45802514 CTGAAGTTTCATTTTAGGAAAGG + Intergenic
1195738952 X:108042919-108042941 CAGCAGCTCCATGTTAGGAAGGG - Intergenic