ID: 939623922

View in Genome Browser
Species Human (GRCh38)
Location 2:144453110-144453132
Sequence ACAATCTGTTAATACAACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939623917_939623922 30 Left 939623917 2:144453057-144453079 CCAAAACCATTTCCTTATCATCT No data
Right 939623922 2:144453110-144453132 ACAATCTGTTAATACAACTAAGG No data
939623919_939623922 24 Left 939623919 2:144453063-144453085 CCATTTCCTTATCATCTGGCATG No data
Right 939623922 2:144453110-144453132 ACAATCTGTTAATACAACTAAGG No data
939623920_939623922 18 Left 939623920 2:144453069-144453091 CCTTATCATCTGGCATGCTAACG No data
Right 939623922 2:144453110-144453132 ACAATCTGTTAATACAACTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939623922 Original CRISPR ACAATCTGTTAATACAACTA AGG Intronic
No off target data available for this crispr