ID: 939624663

View in Genome Browser
Species Human (GRCh38)
Location 2:144462057-144462079
Sequence TTCCTCTGTACAGGGTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939624657_939624663 -6 Left 939624657 2:144462040-144462062 CCACTCTTTGCCATCCTTTCCTC 0: 1
1: 0
2: 7
3: 130
4: 1208
Right 939624663 2:144462057-144462079 TTCCTCTGTACAGGGTAAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 138
939624655_939624663 8 Left 939624655 2:144462026-144462048 CCTTTGTACCACAGCCACTCTTT 0: 1
1: 0
2: 0
3: 12
4: 172
Right 939624663 2:144462057-144462079 TTCCTCTGTACAGGGTAAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 138
939624656_939624663 0 Left 939624656 2:144462034-144462056 CCACAGCCACTCTTTGCCATCCT 0: 1
1: 0
2: 1
3: 44
4: 638
Right 939624663 2:144462057-144462079 TTCCTCTGTACAGGGTAAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939624663 Original CRISPR TTCCTCTGTACAGGGTAAGG AGG Intronic