ID: 939624663

View in Genome Browser
Species Human (GRCh38)
Location 2:144462057-144462079
Sequence TTCCTCTGTACAGGGTAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939624657_939624663 -6 Left 939624657 2:144462040-144462062 CCACTCTTTGCCATCCTTTCCTC 0: 1
1: 0
2: 7
3: 130
4: 1208
Right 939624663 2:144462057-144462079 TTCCTCTGTACAGGGTAAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 138
939624656_939624663 0 Left 939624656 2:144462034-144462056 CCACAGCCACTCTTTGCCATCCT 0: 1
1: 0
2: 1
3: 44
4: 638
Right 939624663 2:144462057-144462079 TTCCTCTGTACAGGGTAAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 138
939624655_939624663 8 Left 939624655 2:144462026-144462048 CCTTTGTACCACAGCCACTCTTT 0: 1
1: 0
2: 0
3: 12
4: 172
Right 939624663 2:144462057-144462079 TTCCTCTGTACAGGGTAAGGAGG 0: 1
1: 0
2: 2
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939624663 Original CRISPR TTCCTCTGTACAGGGTAAGG AGG Intronic
900831132 1:4966443-4966465 CTCCCCTGTACAGGGTAGGAGGG + Intergenic
901246751 1:7737721-7737743 TTCTTCTGTACTGGGGGAGGGGG - Intronic
903801989 1:25975896-25975918 GTCATCTGGCCAGGGTAAGGAGG - Intronic
905034814 1:34911034-34911056 TTCTTCTGTACACTGGAAGGTGG - Intronic
911006683 1:93233531-93233553 TTCCACTGGACAGGCTGAGGAGG - Intronic
911574340 1:99557253-99557275 CTCCTCTGTTCTGGGTAAGTGGG - Intergenic
917627671 1:176862438-176862460 GTCCTCTGTGCAGTGGAAGGAGG - Exonic
922991888 1:229921128-229921150 TTCCACAGTACAGGGTCATGCGG + Intergenic
1063378039 10:5565871-5565893 TTCCTCCGTGCAGATTAAGGAGG + Intergenic
1065042167 10:21708257-21708279 TTCATCTGTTCAGGATAGGGAGG - Intronic
1068049625 10:51932838-51932860 TTCCTTTGTACTTGGAAAGGAGG + Intronic
1068942115 10:62690420-62690442 TTCCTTTGTTCAGGGCAAGCAGG - Intergenic
1070589864 10:77794175-77794197 TTCCTCTGTCCAGGCTAACAGGG + Intronic
1074384315 10:113005041-113005063 TGCCTCGGTTCAGGGGAAGGGGG + Intronic
1075266265 10:121001704-121001726 TGCCTCTGTCCCTGGTAAGGAGG - Intergenic
1077028580 11:452698-452720 TTCCTCTGCACAGGGAAGGGAGG - Intronic
1078535096 11:12166922-12166944 TTGCTCTGTAATGGGAAAGGAGG + Intronic
1080610477 11:33899778-33899800 TTCCTCTGGACAGGGTTAGGTGG + Intergenic
1080884322 11:36352515-36352537 TTCATCTGTAAAGGGGAAAGGGG - Intronic
1084552301 11:69851996-69852018 TGCCTCTGTGAAGGGTCAGGGGG + Intergenic
1085132219 11:74050350-74050372 CTCTTCTCTACATGGTAAGGGGG + Intronic
1086136795 11:83449794-83449816 TTCCACTGTACAGACTGAGGAGG - Intergenic
1087971316 11:104488296-104488318 TTTTTCTGTGCAGGGTCAGGTGG + Intergenic
1089167883 11:116491192-116491214 TTCCTCTGAAGATGGTTAGGTGG - Intergenic
1099296198 12:80830951-80830973 TTAATCAGTACAGCGTAAGGAGG - Intronic
1101431154 12:104628524-104628546 TTCCGTTGTCCAGGGTAACGTGG + Intronic
1102302472 12:111780663-111780685 TTCATCTGTACAGTCTGAGGTGG + Intronic
1103890285 12:124233353-124233375 TTTTTCTGTACAGGGTCAGATGG - Intronic
1105996130 13:25673835-25673857 TGGCTCTGCACAGGGAAAGGAGG + Intronic
1107811787 13:44207513-44207535 TTCCTCTTTACTGGGAAAAGGGG - Intergenic
1108422403 13:50264793-50264815 TTCCTCTTCCCAGGGGAAGGAGG - Intronic
1108703716 13:52966021-52966043 TGCATCTGTACAGGGCAGGGTGG - Intergenic
1113364297 13:109661869-109661891 TGCCTCTGGGCAGGGCAAGGAGG + Intergenic
1119229724 14:72970508-72970530 CTCCTCCGCACAGGGTGAGGTGG - Exonic
1119320023 14:73725055-73725077 TTCCTCACTTCAGGGTAGGGTGG - Intronic
1121008646 14:90506802-90506824 TTCCTCTGTAAAGGGCCAGAGGG + Intergenic
1121639682 14:95476759-95476781 TTACTCTGTACAAGGTATTGTGG - Intergenic
1122913011 14:104843014-104843036 TTCCACAGCACAGGGAAAGGCGG - Intergenic
1202919016 14_KI270723v1_random:13638-13660 TTCCTGTGGGCAGGCTAAGGTGG + Intergenic
1202925613 14_KI270724v1_random:21357-21379 TTCCTGTGGGCAGGCTAAGGTGG - Intergenic
1125087549 15:35748093-35748115 CTCCTCTGTACAGAGGCAGGGGG + Intergenic
1125956729 15:43795532-43795554 TTCCTCTCTCCAGGGCAAAGGGG - Exonic
1127462410 15:59211607-59211629 TTCCTCTAAACAGGTTAAGTGGG - Intronic
1128198212 15:65779600-65779622 TTCCCCTGTAGAGGCTGAGGTGG - Intronic
1129309571 15:74696525-74696547 TTCCTGTGTACTGAGTATGGGGG - Intergenic
1130079673 15:80721714-80721736 TTCCTCTGTGCAGCGTAAGGTGG + Intronic
1131122426 15:89830814-89830836 TGCCACTGTACAGGGTGATGGGG + Exonic
1131820470 15:96267976-96267998 TTCCTCTGCACAGTATAAGAGGG + Intergenic
1131904895 15:97132548-97132570 ATCCTCTGATCAGGGTAGGGGGG + Intergenic
1134666210 16:16020611-16020633 TTCTTCTGTAAAGGGTCAGATGG - Intronic
1138644979 16:58418110-58418132 TTACACTGTAAAGGGCAAGGCGG + Intergenic
1138741004 16:59310161-59310183 TTCCTCTCTTGTGGGTAAGGAGG - Intergenic
1140251884 16:73301549-73301571 GTCCTCTGGACAGGGTTAGGGGG + Intergenic
1143336721 17:6177009-6177031 TTCCTGTGGACAGGGTGATGTGG - Intergenic
1144416383 17:15051337-15051359 TTCATCTGTAAAGAGAAAGGGGG - Intergenic
1146549787 17:33770323-33770345 TTCCTCTGTAAAGCGAAAGCTGG + Intronic
1147178925 17:38673156-38673178 TTCCTCTGCAAAGGATGAGGGGG + Exonic
1150501421 17:65654424-65654446 TTCCTATGAACAGGGAATGGAGG - Intronic
1153254027 18:3152399-3152421 ATCCTGTGTAGAGGGTAAGAAGG + Intronic
1157234683 18:45953431-45953453 TATCTCTGTACATAGTAAGGAGG - Intronic
1158458128 18:57625152-57625174 TTCATCTGGACAGGCTATGGTGG - Intergenic
1158619685 18:59021819-59021841 TTCCTCTGTACAGTGAGGGGTGG + Intergenic
1160387758 18:78506818-78506840 TTCCTCTGTAAAGCCCAAGGCGG + Intergenic
1160671337 19:365283-365305 TGCCCTTGTGCAGGGTAAGGGGG + Intronic
1167107917 19:47441438-47441460 TTCCTGTGCAGGGGGTAAGGGGG + Exonic
1167304344 19:48698359-48698381 TTCCTCCTTCCTGGGTAAGGAGG + Intronic
1167424864 19:49425020-49425042 TTCCTATGTTCTGGGGAAGGAGG + Intronic
1168142880 19:54401017-54401039 TTCCTCTGTGGAGGGAAAGGTGG - Intergenic
931705204 2:64941392-64941414 TTCCTCTGGCCAGGATGAGGAGG - Intergenic
932769787 2:74494181-74494203 TTCCTCTGTGAAAGGTAAGGGGG - Exonic
933667377 2:84974514-84974536 TTCTTCTGTAAAGGGCTAGGTGG + Intronic
933704263 2:85277994-85278016 TGCCTCTGTACAGGGCATGCTGG + Intronic
937291097 2:120782567-120782589 TGCCTCTTTACAGCTTAAGGTGG + Intronic
939624663 2:144462057-144462079 TTCCTCTGTACAGGGTAAGGAGG + Intronic
939760108 2:146165183-146165205 TTCCTCTTTACTGTTTAAGGAGG - Intergenic
940040489 2:149354694-149354716 TTTCACTGTACAGCATAAGGGGG + Intronic
946379430 2:219335190-219335212 TGCCTCTCTGCAGGGTAATGGGG + Intergenic
947378964 2:229526507-229526529 TTTCCCTGGACAGGGTAGGGGGG + Intronic
1170239454 20:14147099-14147121 TTCTTATGTACTGGGTAATGAGG + Intronic
1173306204 20:41852470-41852492 ATCCTCTGGAGAGGGAAAGGAGG - Intergenic
1173428477 20:42963726-42963748 TTCCCCTGTGCAGGGTAGGGTGG - Intronic
1173916570 20:46712427-46712449 TTCCCCGGGACAGGGTCAGGGGG - Intronic
1174085438 20:48004692-48004714 TCCCTCTGTCCATGGTATGGGGG + Intergenic
1174128618 20:48326566-48326588 TTTCACTGCACAGGGCAAGGAGG + Intergenic
1175830639 20:61963513-61963535 TTCCTCTGGAGATGGAAAGGAGG + Intronic
1176226757 20:64004681-64004703 TTCCTCTGTAAAAGGGAAGAGGG + Intronic
1176304395 21:5115682-5115704 CTCCCATGTCCAGGGTAAGGTGG - Intergenic
1179852663 21:44146348-44146370 CTCCCATGTCCAGGGTAAGGTGG + Intergenic
1181368694 22:22399321-22399343 TTCCTCTGCAGATGGCAAGGGGG + Intergenic
1182941992 22:34285757-34285779 CTCCTCTGTACAGACAAAGGAGG - Intergenic
949946120 3:9191479-9191501 TGCCTATGTACATGGGAAGGAGG + Intronic
951007906 3:17640039-17640061 TTTCTCTGTAGAGGTGAAGGGGG - Intronic
954676116 3:52316301-52316323 TGCCTCTCTACAGGCCAAGGGGG + Exonic
954885439 3:53869395-53869417 TTCCTGTGTACAGGGTAAATAGG - Intronic
957518451 3:81287168-81287190 TTCTTCTTTACAAGGTAAGATGG + Intergenic
958931764 3:100215087-100215109 TTCCTCTATCAAGGTTAAGGAGG - Intergenic
962899383 3:139745682-139745704 TTCCTCTGAACAATGTAAGGGGG - Intergenic
962923936 3:139974852-139974874 GACCTCTGTACAGGGCCAGGGGG - Intronic
965681020 3:171251486-171251508 TTCCTCTGTCCTGGGCAAGTTGG + Intronic
965942639 3:174203316-174203338 TTCCTCTGTGCACGGTGAAGTGG - Intronic
967667265 3:192188299-192188321 GTCCTCTTTACAGGTTAATGGGG + Intronic
970681382 4:18512381-18512403 TTCCTCTTTTCAGAGTAAAGAGG + Intergenic
974222574 4:58995686-58995708 TTCTTCTGTACAGGCTAAAGTGG + Intergenic
979473307 4:121126105-121126127 TTCCTCTGTTCTTGGAAAGGAGG - Intergenic
981335331 4:143562889-143562911 TGACTCTGTACAGGGTAATGGGG - Intergenic
982406635 4:155027630-155027652 TTCCTCTGTACATGGATAGATGG - Intergenic
982987045 4:162222915-162222937 TTCCTCAGTTCATGGTAAGTAGG - Intergenic
983355951 4:166657433-166657455 TTCCTATGTACAGTGTTAAGTGG + Intergenic
985717356 5:1470165-1470187 TGCCTCTGTACAGGCAAAGCCGG + Intronic
988672575 5:33397575-33397597 TTCCTCTGACCATGGTGAGGAGG - Intergenic
991456251 5:66807661-66807683 TTCCTCTATGCAGGGAAAGTGGG - Intronic
996256808 5:121414387-121414409 CTCGTCTGTACATGGTAAAGTGG - Intergenic
997113965 5:131105511-131105533 TTCCTCTGCACTGGGTCAAGAGG - Intergenic
998352668 5:141511552-141511574 TTCCTCTTTCCCGAGTAAGGTGG + Exonic
999874070 5:155782859-155782881 TTCCACTGACCAGGGTAAAGAGG - Intergenic
1000378301 5:160604933-160604955 TTTTTCTGTAAAGGGTCAGGTGG + Intronic
1000767725 5:165312709-165312731 TTCCCCTGCACAGGGTAATTGGG - Intergenic
1000771897 5:165364961-165364983 TTCCTCTGCACAAGGCAAGCTGG - Intergenic
1002153895 5:177259600-177259622 TTCCTCTGGAGAGGGTAGAGAGG + Intronic
1003089506 6:3090157-3090179 TTGCTAAGTACAGGGGAAGGAGG - Intronic
1007916357 6:45565271-45565293 TGCCTCTGGGCAGGGTCAGGAGG + Intronic
1007957508 6:45930633-45930655 TTCCTCATTACAGGGAAAGCTGG + Intronic
1007966005 6:46004333-46004355 TTCCTCTGTGCAAGGGAAGCTGG - Intronic
1011114448 6:83874731-83874753 TTCCTCTGTACCTGGTATGTAGG + Intronic
1012328219 6:97950603-97950625 TTCCACTGAACAGGATAAGGTGG - Intergenic
1013350105 6:109297975-109297997 TTCCTTTGCAAAGGATAAGGAGG + Intergenic
1013766414 6:113579124-113579146 TTCCTGTGTTCCAGGTAAGGAGG - Intergenic
1014845162 6:126266918-126266940 TTTATCTTTACAGGTTAAGGAGG - Intergenic
1015755072 6:136598614-136598636 TCCCTCTCTAAAGGGGAAGGGGG + Intronic
1016531712 6:145065679-145065701 CTCCTCTGTGCAGGGAAAAGAGG + Intergenic
1018731660 6:166656387-166656409 TTCCTCTGTGAAGGGTTGGGCGG + Intronic
1020011823 7:4809410-4809432 TTCCTGTGTGCACGGAAAGGAGG - Intronic
1021856071 7:24857626-24857648 TCCCTCTGTACTGGCTAAGTAGG - Intronic
1021860636 7:24902637-24902659 AGCCTCTGTACAGTGTAAGTTGG - Intronic
1031619703 7:123921142-123921164 TTCCTCTGTTCTTGGTGAGGAGG + Intergenic
1031761611 7:125719259-125719281 TTTCTCTGTAAAGGGAAAGATGG - Intergenic
1037066256 8:14581579-14581601 TGCCTCTGGACAAAGTAAGGTGG - Intronic
1039333647 8:36566504-36566526 TCCCTCTGTAAAGGGTGAGGAGG + Intergenic
1045322828 8:101095001-101095023 ATGCTCTGGAAAGGGTAAGGAGG - Intergenic
1048180756 8:132192321-132192343 TTCCTCTTCTCAGGTTAAGGAGG - Intronic
1050127788 9:2377303-2377325 TTCTTCTGAAAAGGGTGAGGCGG + Intergenic
1050149253 9:2602661-2602683 TTCCTCTCTACATGGCAAGGTGG + Intergenic
1055466828 9:76574389-76574411 CTCCCCTGAACAGGGTGAGGAGG - Intergenic
1057439367 9:95071877-95071899 TTCCTCTGTACAAGGAAACATGG - Intronic
1059634733 9:116159742-116159764 TTCCTCTGTGCAGGGAAAAATGG - Intronic
1186732092 X:12420634-12420656 TGCCTGTGTTCAGGGTAAGAAGG - Intronic
1186800068 X:13083929-13083951 TTCCTCTGTACAGAGACAGAGGG + Intergenic
1186844811 X:13520150-13520172 TTTGTCTGTACAGCGAAAGGTGG - Intergenic
1192238484 X:69311677-69311699 CTCCTCAGTACAAGGCAAGGAGG + Intergenic
1196041455 X:111209078-111209100 TTCTTCTGTACAGGCAGAGGTGG + Intronic
1196728687 X:118920691-118920713 TTGCTCTTTTCAGGGTAAAGAGG - Intergenic
1198415899 X:136419430-136419452 TTCCTGGGTACAGGGGAAGTGGG - Intergenic
1199013632 X:142786007-142786029 TTCCACTGTATAGGGTTAGGGGG + Intergenic
1199965400 X:152816266-152816288 TTTCTCTGGAGAGGGGAAGGAGG - Intergenic