ID: 939625641

View in Genome Browser
Species Human (GRCh38)
Location 2:144473697-144473719
Sequence TAGGGTTGTTACAGAGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939625636_939625641 5 Left 939625636 2:144473669-144473691 CCAAGAAGATGATCTAGAAGCAG No data
Right 939625641 2:144473697-144473719 TAGGGTTGTTACAGAGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939625641 Original CRISPR TAGGGTTGTTACAGAGGTGC AGG Intronic
No off target data available for this crispr