ID: 939626785

View in Genome Browser
Species Human (GRCh38)
Location 2:144486874-144486896
Sequence CAATTCTTCTGAACTGGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939626781_939626785 -3 Left 939626781 2:144486854-144486876 CCCCATTACAAAAATAAAGTCAA No data
Right 939626785 2:144486874-144486896 CAATTCTTCTGAACTGGTATTGG No data
939626783_939626785 -5 Left 939626783 2:144486856-144486878 CCATTACAAAAATAAAGTCAATT No data
Right 939626785 2:144486874-144486896 CAATTCTTCTGAACTGGTATTGG No data
939626780_939626785 15 Left 939626780 2:144486836-144486858 CCTAAGAATTTTTCTTGGCCCCA No data
Right 939626785 2:144486874-144486896 CAATTCTTCTGAACTGGTATTGG No data
939626782_939626785 -4 Left 939626782 2:144486855-144486877 CCCATTACAAAAATAAAGTCAAT No data
Right 939626785 2:144486874-144486896 CAATTCTTCTGAACTGGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939626785 Original CRISPR CAATTCTTCTGAACTGGTAT TGG Intronic