ID: 939628759

View in Genome Browser
Species Human (GRCh38)
Location 2:144510359-144510381
Sequence ACCAGAGAGGTGAGGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939628759_939628766 18 Left 939628759 2:144510359-144510381 CCCAGGGCCCTCACCTCTCTGGT No data
Right 939628766 2:144510400-144510422 ACTTATTAAAGCCAAATCGTAGG No data
939628759_939628768 30 Left 939628759 2:144510359-144510381 CCCAGGGCCCTCACCTCTCTGGT No data
Right 939628768 2:144510412-144510434 CAAATCGTAGGCAGCACTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939628759 Original CRISPR ACCAGAGAGGTGAGGGCCCT GGG (reversed) Intronic
No off target data available for this crispr