ID: 939629091

View in Genome Browser
Species Human (GRCh38)
Location 2:144513408-144513430
Sequence CAGAGTTTCCACTAAAGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629091 Original CRISPR CAGAGTTTCCACTAAAGGGT TGG (reversed) Intronic
900352746 1:2243917-2243939 CTGAGATTCCCCTAAAAGGTGGG + Intronic
903744356 1:25576776-25576798 CTCAGTTTCCACTGAAGGGCAGG - Intergenic
904998884 1:34652643-34652665 CAGGTTGTCCACCAAAGGGTGGG + Intergenic
907594128 1:55704016-55704038 CAGAGTTACCACCAACGGGAGGG - Intergenic
908649476 1:66315891-66315913 CAGAGTTTTCACTGAGGGCTTGG + Intronic
909905548 1:81190348-81190370 CAGAGTTTCGGCTAAAGTGAAGG - Intergenic
912880182 1:113404282-113404304 AAGAATTTCCAATTAAGGGTGGG + Intronic
919067413 1:192710551-192710573 CAGACTATCCAGGAAAGGGTTGG - Intergenic
1069750419 10:70741831-70741853 CAGAGCATCCAGTGAAGGGTTGG + Intronic
1070635206 10:78120104-78120126 TGGAGTTTCCACTAATAGGTTGG - Intergenic
1071767731 10:88688039-88688061 CAGATTTGCCACTAGAGGGTAGG + Intergenic
1076848891 10:133083374-133083396 CAGAGTCTCCACCAAATGGCTGG + Intronic
1077955336 11:7013269-7013291 CATTGTTTCCACTGAAAGGTGGG - Intronic
1081949276 11:47029200-47029222 CATATTTTCCACTAACAGGTTGG - Intronic
1087861979 11:103169622-103169644 CAAAGTTTCTACTAAACTGTAGG - Intronic
1091271718 11:134318420-134318442 CAGCCTTACCATTAAAGGGTTGG + Intronic
1093363813 12:18267622-18267644 CAGATTTTCAACTAAAGGGATGG + Intronic
1093997087 12:25654402-25654424 CAGAGCTTACACTGTAGGGTTGG + Intergenic
1096209965 12:49757210-49757232 CAGAGTTTCCCCTAATGGATGGG - Intronic
1105710951 13:23008391-23008413 CAAAGTTTCCACCAAAGATTAGG + Intergenic
1106767091 13:32923874-32923896 CAGAGTTACCAGTAAAGGGCTGG + Intergenic
1112280385 13:98057787-98057809 CAGACTTTACACAAAAGCGTGGG + Intergenic
1113300017 13:109008147-109008169 CAGAGTTTCAACTGAAGTCTAGG - Intronic
1113594464 13:111521300-111521322 CAGAGTATCCACCAAGGGGGAGG - Intergenic
1114293443 14:21307728-21307750 CAGAGCTTCCATTAAAGAGAAGG + Exonic
1115629560 14:35230346-35230368 CAGAATTTACAGTAATGGGTTGG - Intronic
1117581070 14:57152365-57152387 CAGAGTTTTGACTACATGGTGGG + Intergenic
1121965352 14:98298527-98298549 AAGAATTTCTACTCAAGGGTAGG + Intergenic
1125845736 15:42851423-42851445 AATAGTTTCTACTAAAGGCTGGG + Intronic
1125980459 15:43995975-43995997 CAGAGGCTCCCCTACAGGGTGGG + Intronic
1128568288 15:68715382-68715404 CTGATTTTCCACTTAAGGGAGGG - Intronic
1128944933 15:71813652-71813674 CAGAATTCCCACTCAAGGTTTGG - Intronic
1129789289 15:78330146-78330168 CAGAGTTCCCATTTAAGGGTAGG + Intergenic
1130831820 15:87608702-87608724 CAGATTTTCCACTATAAAGTGGG - Intergenic
1132083047 15:98883911-98883933 AAGAGTTTTCAACAAAGGGTTGG - Intronic
1132492685 16:242122-242144 CAGAGTTTCCACTCAGGACTGGG + Intronic
1133042377 16:3067518-3067540 CAGAGTTGGCACCAAAGGGCCGG - Intronic
1137299349 16:47132773-47132795 CAGAGTATCCACTGAAGAGCGGG + Intronic
1139026476 16:62824303-62824325 CAGAGTATCCACTGAAGAGAAGG - Intergenic
1143740899 17:8953364-8953386 CAGAGCTTGGCCTAAAGGGTGGG - Intronic
1144845775 17:18218089-18218111 CAGTGTTTCCACTCCAGGCTGGG + Intergenic
1150869928 17:68895924-68895946 CAGAGTTTCCACGACAGGAGAGG + Intronic
1151661886 17:75523541-75523563 CAGAGGTGCCACTTGAGGGTTGG - Intronic
1157782039 18:50448152-50448174 CAGAGTGTCCACTAAAGGTAGGG - Intergenic
1159076886 18:63690344-63690366 CATAGATTCAAATAAAGGGTTGG + Intronic
1159123509 18:64196933-64196955 CAGAGTTATCACTAATGAGTAGG - Intergenic
1160024261 18:75205378-75205400 CACAGTTTCAATTAAAGGGGGGG - Intronic
1160086106 18:75778961-75778983 AAGAGTTTCCACTGACGGGTTGG - Intergenic
1163891854 19:20023684-20023706 AAGAATTACCACTAAAGGCTGGG + Intronic
1167330024 19:48849709-48849731 CAGAGCTTGCACTAAAGGAATGG + Intronic
1167873823 19:52395306-52395328 CATAGTTTCCCCTAGAGGTTGGG - Intergenic
929682631 2:44006896-44006918 CAGAGTTTCAACAAAAGGGCCGG + Intergenic
932861017 2:75291290-75291312 CAGGATTTCCACTATAGAGTGGG - Intergenic
934160064 2:89241044-89241066 CTGGGTCTCCACTAAAGGCTGGG - Intergenic
934207210 2:89941390-89941412 CTGGGTCTCCACTAAAGGCTGGG + Intergenic
939629091 2:144513408-144513430 CAGAGTTTCCACTAAAGGGTTGG - Intronic
941260744 2:163293388-163293410 GAGAGTTTCAACTAAGGTGTGGG + Intergenic
944483286 2:200178693-200178715 CAGAGTTTTCAATACAGAGTAGG - Intergenic
946064056 2:216971006-216971028 CACAATTTCCATTAAAAGGTGGG - Intergenic
947148750 2:227092731-227092753 CAGAGTTTACACTGAATAGTTGG - Intronic
948132460 2:235610737-235610759 CAGGGTTTCCACTCCAGGGCAGG - Intronic
1169199522 20:3701462-3701484 CAGAGGTACCACTGAAGCGTGGG + Exonic
1171257870 20:23704515-23704537 CAGACTTTCCACTCAGGGGAAGG + Intergenic
1173428692 20:42966557-42966579 CAGAGTTTCTACTATAAGTTGGG - Intronic
1173582437 20:44157129-44157151 CAGAGTCACCACTACAGTGTCGG - Intronic
1181918620 22:26301426-26301448 CAGAGTTTCCAGTCAAGGTGAGG + Intronic
1182393801 22:30020851-30020873 CAAAGTCTCCATTAAAGTGTAGG - Exonic
951472565 3:23071872-23071894 CAGAATTTCCGCTAATGGGCAGG + Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
957933741 3:86915389-86915411 AAGAGATGCCATTAAAGGGTGGG - Intergenic
960442225 3:117703028-117703050 TAGGGTTTCCACCAAAGTGTTGG - Intergenic
961753454 3:129111670-129111692 CAGAGTTTACACTGAAGTATTGG + Intronic
964148077 3:153490462-153490484 CAGAGCTTTTACTAATGGGTAGG + Intronic
964612321 3:158627671-158627693 CAAAGCTTCCACTGAAGGATAGG - Intergenic
968747060 4:2365562-2365584 CAGGGCTCCCACCAAAGGGTGGG - Intronic
972129677 4:35816344-35816366 GAAAGTTTCCACTAAAGTATTGG - Intergenic
972360682 4:38323043-38323065 GAGAGCTTGCATTAAAGGGTAGG - Intergenic
974774917 4:66466829-66466851 CAGAGTTCCCCCAAAAGGGAGGG - Intergenic
976679484 4:87739255-87739277 AAGATTTTCCACTAATAGGTGGG - Intergenic
978366695 4:107990105-107990127 CAGAGCTTCCACCTCAGGGTGGG - Intronic
979095426 4:116543832-116543854 AAGAGTGTCCAATAAAGGCTGGG + Intergenic
979651167 4:123133324-123133346 CACAGTTTCCACTAAAGAACTGG - Intronic
981463355 4:145036910-145036932 CATAGTTTTCCCTAAAGGGTAGG + Intronic
982233782 4:153233209-153233231 AAGAGTTTCCAGTAGAAGGTGGG + Intronic
984627023 4:182019143-182019165 CACAATATCCACTAAAGGGTTGG - Intergenic
985004653 4:185522006-185522028 TAGAGTTTTGACTAAAGGGAAGG - Intronic
987587253 5:19872019-19872041 AAGAGTTTCCACTAAATGAAAGG - Intronic
988632223 5:32943727-32943749 CAGAGCAACCACTAAAGGCTGGG + Intergenic
989228665 5:39061382-39061404 CAGACCTTCCACTCATGGGTAGG - Intronic
990378076 5:55193044-55193066 GAGAGTTTTGACTAAAGGGAAGG - Intergenic
994783021 5:104116781-104116803 CAGAGTTTCCTCTAAAGAAAGGG + Intergenic
996541667 5:124636238-124636260 CAGAGTGGCCACTAAAGAGATGG - Intergenic
998411967 5:141918271-141918293 CAGAGTTGCCTCTAGAGAGTAGG + Intergenic
1000311796 5:160052159-160052181 CAGATTTTCCAAAAAAGGGAGGG + Intronic
1003110436 6:3248414-3248436 CAGTGTTTCCATTAAAATGTGGG - Intronic
1004661614 6:17715612-17715634 CAGAGTCTCCTCTCAAGGTTTGG + Intergenic
1006436053 6:34026727-34026749 CAGAGGGTCCCATAAAGGGTGGG - Intronic
1007156214 6:39746881-39746903 CAGAGTTTTGACTACAGGGGTGG + Intergenic
1012681749 6:102191530-102191552 AAGAGTTTCCACAAAAGGGGAGG - Intergenic
1016316316 6:142792224-142792246 CAGAGTTTGCCCGAAAGGGATGG - Intronic
1017239150 6:152147761-152147783 CAGAGCTTCCACTCTAGTGTGGG - Intronic
1018785218 6:167103016-167103038 CAGTGTTTCCCCTAGAGGGTTGG + Intergenic
1020786788 7:12583670-12583692 CAGAGTTTCCACTATGGGCCAGG + Intronic
1024958868 7:54954460-54954482 CAGAGCTACCTCTAAAGGCTGGG + Intergenic
1027701046 7:81470503-81470525 CAGAGTTTCCTCTAAAGGCTTGG + Intergenic
1031697078 7:124870967-124870989 CATAGTTTCCACTAAAGAGCAGG + Exonic
1037473605 8:19235916-19235938 CTGAATTTCCACTACAGTGTAGG - Intergenic
1039028838 8:33287536-33287558 CAGGCTTTCTACTAAAGGATTGG + Intergenic
1039569255 8:38574038-38574060 CAGAGAATCCCCTAAAGGGGAGG - Intergenic
1040840717 8:51781589-51781611 AAGAGTTTCCACTAAAAGGAAGG - Intronic
1042686324 8:71444877-71444899 CATAGTTTCCACAAATAGGTTGG - Intronic
1045128208 8:99118371-99118393 TAGAGTTTCTACTAAGTGGTGGG + Intronic
1045768131 8:105701355-105701377 CAGAATATAAACTAAAGGGTAGG - Intronic
1053228088 9:36379345-36379367 CACAGTTTCCAGAAAAGGGAAGG + Intronic
1054951359 9:70855634-70855656 CAGATTTTCCACTAGAGGCTTGG - Intronic
1055161708 9:73137399-73137421 CAGAGTGTACACTAGAGGGTGGG + Intergenic
1057032739 9:91788953-91788975 AATAGTGGCCACTAAAGGGTGGG + Intronic
1060520364 9:124290747-124290769 CAGGGTTTGGACTAAAGGGGAGG - Intronic
1060575478 9:124688472-124688494 CAGAGTTACCAATTAATGGTTGG + Intronic
1060576837 9:124703511-124703533 CAAACATTCCACTAAAAGGTAGG - Intronic
1060820287 9:126657986-126658008 CAGAGTTTCCAGAAGAGGCTGGG + Intronic
1186341312 X:8649141-8649163 CAGAGTATTCACAAAAGGGCCGG + Intronic
1192239601 X:69318965-69318987 CTGAGTTCCCAGTAAAGAGTTGG - Intergenic
1192626973 X:72739000-72739022 CAGAGTTTCCATTTAACGTTTGG - Intergenic
1195146103 X:102018762-102018784 CAAAGTTACCACTCAAAGGTGGG + Intergenic
1196215736 X:113049994-113050016 CAGGGTTACCACTAGAGGATGGG - Intergenic
1199062762 X:143378009-143378031 CAGAGTTTCTGCTAAATGGAAGG - Intergenic
1200217877 X:154376503-154376525 GAGAGTTTCCCGTCAAGGGTAGG - Intergenic
1202081036 Y:21084554-21084576 AAGAGTTACCACTACAGTGTTGG - Intergenic