ID: 939629277

View in Genome Browser
Species Human (GRCh38)
Location 2:144514917-144514939
Sequence GCCAGAGATGTCCGCAGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629277_939629279 7 Left 939629277 2:144514917-144514939 CCATGACTGCGGACATCTCTGGC No data
Right 939629279 2:144514947-144514969 TCCACCTGCGAAGCGCCCAACGG No data
939629277_939629281 8 Left 939629277 2:144514917-144514939 CCATGACTGCGGACATCTCTGGC No data
Right 939629281 2:144514948-144514970 CCACCTGCGAAGCGCCCAACGGG No data
939629277_939629285 25 Left 939629277 2:144514917-144514939 CCATGACTGCGGACATCTCTGGC No data
Right 939629285 2:144514965-144514987 AACGGGCCTCCCTCTCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629277 Original CRISPR GCCAGAGATGTCCGCAGTCA TGG (reversed) Intronic
No off target data available for this crispr