ID: 939629278

View in Genome Browser
Species Human (GRCh38)
Location 2:144514943-144514965
Sequence TGGGCGCTTCGCAGGTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629278_939629293 18 Left 939629278 2:144514943-144514965 CCATTCCACCTGCGAAGCGCCCA No data
Right 939629293 2:144514984-144515006 CAGGTCTCCTAGGGGTTCCCAGG No data
939629278_939629290 9 Left 939629278 2:144514943-144514965 CCATTCCACCTGCGAAGCGCCCA No data
Right 939629290 2:144514975-144514997 CCTCTCTGCCAGGTCTCCTAGGG No data
939629278_939629291 10 Left 939629278 2:144514943-144514965 CCATTCCACCTGCGAAGCGCCCA No data
Right 939629291 2:144514976-144514998 CTCTCTGCCAGGTCTCCTAGGGG No data
939629278_939629288 8 Left 939629278 2:144514943-144514965 CCATTCCACCTGCGAAGCGCCCA No data
Right 939629288 2:144514974-144514996 CCCTCTCTGCCAGGTCTCCTAGG No data
939629278_939629285 -1 Left 939629278 2:144514943-144514965 CCATTCCACCTGCGAAGCGCCCA No data
Right 939629285 2:144514965-144514987 AACGGGCCTCCCTCTCTGCCAGG No data
939629278_939629295 26 Left 939629278 2:144514943-144514965 CCATTCCACCTGCGAAGCGCCCA No data
Right 939629295 2:144514992-144515014 CTAGGGGTTCCCAGGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629278 Original CRISPR TGGGCGCTTCGCAGGTGGAA TGG (reversed) Intronic
No off target data available for this crispr