ID: 939629280

View in Genome Browser
Species Human (GRCh38)
Location 2:144514948-144514970
Sequence CCCGTTGGGCGCTTCGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629280_939629293 13 Left 939629280 2:144514948-144514970 CCACCTGCGAAGCGCCCAACGGG No data
Right 939629293 2:144514984-144515006 CAGGTCTCCTAGGGGTTCCCAGG No data
939629280_939629291 5 Left 939629280 2:144514948-144514970 CCACCTGCGAAGCGCCCAACGGG No data
Right 939629291 2:144514976-144514998 CTCTCTGCCAGGTCTCCTAGGGG No data
939629280_939629295 21 Left 939629280 2:144514948-144514970 CCACCTGCGAAGCGCCCAACGGG No data
Right 939629295 2:144514992-144515014 CTAGGGGTTCCCAGGAAGCCAGG No data
939629280_939629290 4 Left 939629280 2:144514948-144514970 CCACCTGCGAAGCGCCCAACGGG No data
Right 939629290 2:144514975-144514997 CCTCTCTGCCAGGTCTCCTAGGG No data
939629280_939629285 -6 Left 939629280 2:144514948-144514970 CCACCTGCGAAGCGCCCAACGGG No data
Right 939629285 2:144514965-144514987 AACGGGCCTCCCTCTCTGCCAGG No data
939629280_939629288 3 Left 939629280 2:144514948-144514970 CCACCTGCGAAGCGCCCAACGGG No data
Right 939629288 2:144514974-144514996 CCCTCTCTGCCAGGTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629280 Original CRISPR CCCGTTGGGCGCTTCGCAGG TGG (reversed) Intronic