ID: 939629281

View in Genome Browser
Species Human (GRCh38)
Location 2:144514948-144514970
Sequence CCACCTGCGAAGCGCCCAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629277_939629281 8 Left 939629277 2:144514917-144514939 CCATGACTGCGGACATCTCTGGC No data
Right 939629281 2:144514948-144514970 CCACCTGCGAAGCGCCCAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629281 Original CRISPR CCACCTGCGAAGCGCCCAAC GGG Intronic
No off target data available for this crispr