ID: 939629282

View in Genome Browser
Species Human (GRCh38)
Location 2:144514951-144514973
Sequence AGGCCCGTTGGGCGCTTCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629282_939629295 18 Left 939629282 2:144514951-144514973 CCTGCGAAGCGCCCAACGGGCCT No data
Right 939629295 2:144514992-144515014 CTAGGGGTTCCCAGGAAGCCAGG No data
939629282_939629285 -9 Left 939629282 2:144514951-144514973 CCTGCGAAGCGCCCAACGGGCCT No data
Right 939629285 2:144514965-144514987 AACGGGCCTCCCTCTCTGCCAGG No data
939629282_939629291 2 Left 939629282 2:144514951-144514973 CCTGCGAAGCGCCCAACGGGCCT No data
Right 939629291 2:144514976-144514998 CTCTCTGCCAGGTCTCCTAGGGG No data
939629282_939629293 10 Left 939629282 2:144514951-144514973 CCTGCGAAGCGCCCAACGGGCCT No data
Right 939629293 2:144514984-144515006 CAGGTCTCCTAGGGGTTCCCAGG No data
939629282_939629290 1 Left 939629282 2:144514951-144514973 CCTGCGAAGCGCCCAACGGGCCT No data
Right 939629290 2:144514975-144514997 CCTCTCTGCCAGGTCTCCTAGGG No data
939629282_939629288 0 Left 939629282 2:144514951-144514973 CCTGCGAAGCGCCCAACGGGCCT No data
Right 939629288 2:144514974-144514996 CCCTCTCTGCCAGGTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629282 Original CRISPR AGGCCCGTTGGGCGCTTCGC AGG (reversed) Intronic