ID: 939629283

View in Genome Browser
Species Human (GRCh38)
Location 2:144514962-144514984
Sequence GGCAGAGAGGGAGGCCCGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629283_939629290 -10 Left 939629283 2:144514962-144514984 CCCAACGGGCCTCCCTCTCTGCC No data
Right 939629290 2:144514975-144514997 CCTCTCTGCCAGGTCTCCTAGGG No data
939629283_939629295 7 Left 939629283 2:144514962-144514984 CCCAACGGGCCTCCCTCTCTGCC No data
Right 939629295 2:144514992-144515014 CTAGGGGTTCCCAGGAAGCCAGG No data
939629283_939629293 -1 Left 939629283 2:144514962-144514984 CCCAACGGGCCTCCCTCTCTGCC No data
Right 939629293 2:144514984-144515006 CAGGTCTCCTAGGGGTTCCCAGG No data
939629283_939629291 -9 Left 939629283 2:144514962-144514984 CCCAACGGGCCTCCCTCTCTGCC No data
Right 939629291 2:144514976-144514998 CTCTCTGCCAGGTCTCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629283 Original CRISPR GGCAGAGAGGGAGGCCCGTT GGG (reversed) Intronic
No off target data available for this crispr