ID: 939629284

View in Genome Browser
Species Human (GRCh38)
Location 2:144514963-144514985
Sequence TGGCAGAGAGGGAGGCCCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629284_939629299 30 Left 939629284 2:144514963-144514985 CCAACGGGCCTCCCTCTCTGCCA No data
Right 939629299 2:144515016-144515038 TCCCTCTATTTCCTTAGACCTGG No data
939629284_939629295 6 Left 939629284 2:144514963-144514985 CCAACGGGCCTCCCTCTCTGCCA No data
Right 939629295 2:144514992-144515014 CTAGGGGTTCCCAGGAAGCCAGG No data
939629284_939629293 -2 Left 939629284 2:144514963-144514985 CCAACGGGCCTCCCTCTCTGCCA No data
Right 939629293 2:144514984-144515006 CAGGTCTCCTAGGGGTTCCCAGG No data
939629284_939629291 -10 Left 939629284 2:144514963-144514985 CCAACGGGCCTCCCTCTCTGCCA No data
Right 939629291 2:144514976-144514998 CTCTCTGCCAGGTCTCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629284 Original CRISPR TGGCAGAGAGGGAGGCCCGT TGG (reversed) Intronic