ID: 939629285

View in Genome Browser
Species Human (GRCh38)
Location 2:144514965-144514987
Sequence AACGGGCCTCCCTCTCTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629280_939629285 -6 Left 939629280 2:144514948-144514970 CCACCTGCGAAGCGCCCAACGGG No data
Right 939629285 2:144514965-144514987 AACGGGCCTCCCTCTCTGCCAGG No data
939629277_939629285 25 Left 939629277 2:144514917-144514939 CCATGACTGCGGACATCTCTGGC No data
Right 939629285 2:144514965-144514987 AACGGGCCTCCCTCTCTGCCAGG No data
939629282_939629285 -9 Left 939629282 2:144514951-144514973 CCTGCGAAGCGCCCAACGGGCCT No data
Right 939629285 2:144514965-144514987 AACGGGCCTCCCTCTCTGCCAGG No data
939629278_939629285 -1 Left 939629278 2:144514943-144514965 CCATTCCACCTGCGAAGCGCCCA No data
Right 939629285 2:144514965-144514987 AACGGGCCTCCCTCTCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629285 Original CRISPR AACGGGCCTCCCTCTCTGCC AGG Intronic
No off target data available for this crispr