ID: 939629286

View in Genome Browser
Species Human (GRCh38)
Location 2:144514971-144514993
Sequence AGGAGACCTGGCAGAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629286_939629293 -10 Left 939629286 2:144514971-144514993 CCTCCCTCTCTGCCAGGTCTCCT No data
Right 939629293 2:144514984-144515006 CAGGTCTCCTAGGGGTTCCCAGG No data
939629286_939629295 -2 Left 939629286 2:144514971-144514993 CCTCCCTCTCTGCCAGGTCTCCT No data
Right 939629295 2:144514992-144515014 CTAGGGGTTCCCAGGAAGCCAGG No data
939629286_939629303 29 Left 939629286 2:144514971-144514993 CCTCCCTCTCTGCCAGGTCTCCT No data
Right 939629303 2:144515023-144515045 ATTTCCTTAGACCTGGGCTCTGG No data
939629286_939629301 23 Left 939629286 2:144514971-144514993 CCTCCCTCTCTGCCAGGTCTCCT No data
Right 939629301 2:144515017-144515039 CCCTCTATTTCCTTAGACCTGGG No data
939629286_939629299 22 Left 939629286 2:144514971-144514993 CCTCCCTCTCTGCCAGGTCTCCT No data
Right 939629299 2:144515016-144515038 TCCCTCTATTTCCTTAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629286 Original CRISPR AGGAGACCTGGCAGAGAGGG AGG (reversed) Intronic
No off target data available for this crispr