ID: 939629288

View in Genome Browser
Species Human (GRCh38)
Location 2:144514974-144514996
Sequence CCCTCTCTGCCAGGTCTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629278_939629288 8 Left 939629278 2:144514943-144514965 CCATTCCACCTGCGAAGCGCCCA No data
Right 939629288 2:144514974-144514996 CCCTCTCTGCCAGGTCTCCTAGG No data
939629282_939629288 0 Left 939629282 2:144514951-144514973 CCTGCGAAGCGCCCAACGGGCCT No data
Right 939629288 2:144514974-144514996 CCCTCTCTGCCAGGTCTCCTAGG No data
939629280_939629288 3 Left 939629280 2:144514948-144514970 CCACCTGCGAAGCGCCCAACGGG No data
Right 939629288 2:144514974-144514996 CCCTCTCTGCCAGGTCTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629288 Original CRISPR CCCTCTCTGCCAGGTCTCCT AGG Intronic
No off target data available for this crispr