ID: 939629289

View in Genome Browser
Species Human (GRCh38)
Location 2:144514975-144514997
Sequence CCCTAGGAGACCTGGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629289_939629303 25 Left 939629289 2:144514975-144514997 CCTCTCTGCCAGGTCTCCTAGGG No data
Right 939629303 2:144515023-144515045 ATTTCCTTAGACCTGGGCTCTGG No data
939629289_939629301 19 Left 939629289 2:144514975-144514997 CCTCTCTGCCAGGTCTCCTAGGG No data
Right 939629301 2:144515017-144515039 CCCTCTATTTCCTTAGACCTGGG No data
939629289_939629295 -6 Left 939629289 2:144514975-144514997 CCTCTCTGCCAGGTCTCCTAGGG No data
Right 939629295 2:144514992-144515014 CTAGGGGTTCCCAGGAAGCCAGG No data
939629289_939629299 18 Left 939629289 2:144514975-144514997 CCTCTCTGCCAGGTCTCCTAGGG No data
Right 939629299 2:144515016-144515038 TCCCTCTATTTCCTTAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629289 Original CRISPR CCCTAGGAGACCTGGCAGAG AGG (reversed) Intronic
No off target data available for this crispr