ID: 939629290

View in Genome Browser
Species Human (GRCh38)
Location 2:144514975-144514997
Sequence CCTCTCTGCCAGGTCTCCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629278_939629290 9 Left 939629278 2:144514943-144514965 CCATTCCACCTGCGAAGCGCCCA No data
Right 939629290 2:144514975-144514997 CCTCTCTGCCAGGTCTCCTAGGG No data
939629283_939629290 -10 Left 939629283 2:144514962-144514984 CCCAACGGGCCTCCCTCTCTGCC No data
Right 939629290 2:144514975-144514997 CCTCTCTGCCAGGTCTCCTAGGG No data
939629280_939629290 4 Left 939629280 2:144514948-144514970 CCACCTGCGAAGCGCCCAACGGG No data
Right 939629290 2:144514975-144514997 CCTCTCTGCCAGGTCTCCTAGGG No data
939629282_939629290 1 Left 939629282 2:144514951-144514973 CCTGCGAAGCGCCCAACGGGCCT No data
Right 939629290 2:144514975-144514997 CCTCTCTGCCAGGTCTCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629290 Original CRISPR CCTCTCTGCCAGGTCTCCTA GGG Intronic
No off target data available for this crispr