ID: 939629291

View in Genome Browser
Species Human (GRCh38)
Location 2:144514976-144514998
Sequence CTCTCTGCCAGGTCTCCTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629278_939629291 10 Left 939629278 2:144514943-144514965 CCATTCCACCTGCGAAGCGCCCA No data
Right 939629291 2:144514976-144514998 CTCTCTGCCAGGTCTCCTAGGGG No data
939629282_939629291 2 Left 939629282 2:144514951-144514973 CCTGCGAAGCGCCCAACGGGCCT No data
Right 939629291 2:144514976-144514998 CTCTCTGCCAGGTCTCCTAGGGG No data
939629283_939629291 -9 Left 939629283 2:144514962-144514984 CCCAACGGGCCTCCCTCTCTGCC No data
Right 939629291 2:144514976-144514998 CTCTCTGCCAGGTCTCCTAGGGG No data
939629284_939629291 -10 Left 939629284 2:144514963-144514985 CCAACGGGCCTCCCTCTCTGCCA No data
Right 939629291 2:144514976-144514998 CTCTCTGCCAGGTCTCCTAGGGG No data
939629280_939629291 5 Left 939629280 2:144514948-144514970 CCACCTGCGAAGCGCCCAACGGG No data
Right 939629291 2:144514976-144514998 CTCTCTGCCAGGTCTCCTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629291 Original CRISPR CTCTCTGCCAGGTCTCCTAG GGG Intronic
No off target data available for this crispr