ID: 939629293

View in Genome Browser
Species Human (GRCh38)
Location 2:144514984-144515006
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629280_939629293 13 Left 939629280 2:144514948-144514970 CCACCTGCGAAGCGCCCAACGGG No data
Right 939629293 2:144514984-144515006 CAGGTCTCCTAGGGGTTCCCAGG No data
939629282_939629293 10 Left 939629282 2:144514951-144514973 CCTGCGAAGCGCCCAACGGGCCT No data
Right 939629293 2:144514984-144515006 CAGGTCTCCTAGGGGTTCCCAGG No data
939629286_939629293 -10 Left 939629286 2:144514971-144514993 CCTCCCTCTCTGCCAGGTCTCCT No data
Right 939629293 2:144514984-144515006 CAGGTCTCCTAGGGGTTCCCAGG No data
939629284_939629293 -2 Left 939629284 2:144514963-144514985 CCAACGGGCCTCCCTCTCTGCCA No data
Right 939629293 2:144514984-144515006 CAGGTCTCCTAGGGGTTCCCAGG No data
939629278_939629293 18 Left 939629278 2:144514943-144514965 CCATTCCACCTGCGAAGCGCCCA No data
Right 939629293 2:144514984-144515006 CAGGTCTCCTAGGGGTTCCCAGG No data
939629283_939629293 -1 Left 939629283 2:144514962-144514984 CCCAACGGGCCTCCCTCTCTGCC No data
Right 939629293 2:144514984-144515006 CAGGTCTCCTAGGGGTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type