ID: 939629295

View in Genome Browser
Species Human (GRCh38)
Location 2:144514992-144515014
Sequence CTAGGGGTTCCCAGGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629286_939629295 -2 Left 939629286 2:144514971-144514993 CCTCCCTCTCTGCCAGGTCTCCT No data
Right 939629295 2:144514992-144515014 CTAGGGGTTCCCAGGAAGCCAGG No data
939629287_939629295 -5 Left 939629287 2:144514974-144514996 CCCTCTCTGCCAGGTCTCCTAGG No data
Right 939629295 2:144514992-144515014 CTAGGGGTTCCCAGGAAGCCAGG No data
939629283_939629295 7 Left 939629283 2:144514962-144514984 CCCAACGGGCCTCCCTCTCTGCC No data
Right 939629295 2:144514992-144515014 CTAGGGGTTCCCAGGAAGCCAGG No data
939629284_939629295 6 Left 939629284 2:144514963-144514985 CCAACGGGCCTCCCTCTCTGCCA No data
Right 939629295 2:144514992-144515014 CTAGGGGTTCCCAGGAAGCCAGG No data
939629280_939629295 21 Left 939629280 2:144514948-144514970 CCACCTGCGAAGCGCCCAACGGG No data
Right 939629295 2:144514992-144515014 CTAGGGGTTCCCAGGAAGCCAGG No data
939629289_939629295 -6 Left 939629289 2:144514975-144514997 CCTCTCTGCCAGGTCTCCTAGGG No data
Right 939629295 2:144514992-144515014 CTAGGGGTTCCCAGGAAGCCAGG No data
939629282_939629295 18 Left 939629282 2:144514951-144514973 CCTGCGAAGCGCCCAACGGGCCT No data
Right 939629295 2:144514992-144515014 CTAGGGGTTCCCAGGAAGCCAGG No data
939629278_939629295 26 Left 939629278 2:144514943-144514965 CCATTCCACCTGCGAAGCGCCCA No data
Right 939629295 2:144514992-144515014 CTAGGGGTTCCCAGGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629295 Original CRISPR CTAGGGGTTCCCAGGAAGCC AGG Intronic
No off target data available for this crispr