ID: 939629301

View in Genome Browser
Species Human (GRCh38)
Location 2:144515017-144515039
Sequence CCCTCTATTTCCTTAGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629297_939629301 -8 Left 939629297 2:144515002-144515024 CCAGGAAGCCAGGATCCCTCTAT No data
Right 939629301 2:144515017-144515039 CCCTCTATTTCCTTAGACCTGGG No data
939629296_939629301 -7 Left 939629296 2:144515001-144515023 CCCAGGAAGCCAGGATCCCTCTA No data
Right 939629301 2:144515017-144515039 CCCTCTATTTCCTTAGACCTGGG No data
939629286_939629301 23 Left 939629286 2:144514971-144514993 CCTCCCTCTCTGCCAGGTCTCCT No data
Right 939629301 2:144515017-144515039 CCCTCTATTTCCTTAGACCTGGG No data
939629287_939629301 20 Left 939629287 2:144514974-144514996 CCCTCTCTGCCAGGTCTCCTAGG No data
Right 939629301 2:144515017-144515039 CCCTCTATTTCCTTAGACCTGGG No data
939629294_939629301 3 Left 939629294 2:144514991-144515013 CCTAGGGGTTCCCAGGAAGCCAG No data
Right 939629301 2:144515017-144515039 CCCTCTATTTCCTTAGACCTGGG No data
939629292_939629301 11 Left 939629292 2:144514983-144515005 CCAGGTCTCCTAGGGGTTCCCAG No data
Right 939629301 2:144515017-144515039 CCCTCTATTTCCTTAGACCTGGG No data
939629289_939629301 19 Left 939629289 2:144514975-144514997 CCTCTCTGCCAGGTCTCCTAGGG No data
Right 939629301 2:144515017-144515039 CCCTCTATTTCCTTAGACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629301 Original CRISPR CCCTCTATTTCCTTAGACCT GGG Intronic