ID: 939629303

View in Genome Browser
Species Human (GRCh38)
Location 2:144515023-144515045
Sequence ATTTCCTTAGACCTGGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939629296_939629303 -1 Left 939629296 2:144515001-144515023 CCCAGGAAGCCAGGATCCCTCTA No data
Right 939629303 2:144515023-144515045 ATTTCCTTAGACCTGGGCTCTGG No data
939629292_939629303 17 Left 939629292 2:144514983-144515005 CCAGGTCTCCTAGGGGTTCCCAG No data
Right 939629303 2:144515023-144515045 ATTTCCTTAGACCTGGGCTCTGG No data
939629297_939629303 -2 Left 939629297 2:144515002-144515024 CCAGGAAGCCAGGATCCCTCTAT No data
Right 939629303 2:144515023-144515045 ATTTCCTTAGACCTGGGCTCTGG No data
939629298_939629303 -10 Left 939629298 2:144515010-144515032 CCAGGATCCCTCTATTTCCTTAG No data
Right 939629303 2:144515023-144515045 ATTTCCTTAGACCTGGGCTCTGG No data
939629289_939629303 25 Left 939629289 2:144514975-144514997 CCTCTCTGCCAGGTCTCCTAGGG No data
Right 939629303 2:144515023-144515045 ATTTCCTTAGACCTGGGCTCTGG No data
939629287_939629303 26 Left 939629287 2:144514974-144514996 CCCTCTCTGCCAGGTCTCCTAGG No data
Right 939629303 2:144515023-144515045 ATTTCCTTAGACCTGGGCTCTGG No data
939629294_939629303 9 Left 939629294 2:144514991-144515013 CCTAGGGGTTCCCAGGAAGCCAG No data
Right 939629303 2:144515023-144515045 ATTTCCTTAGACCTGGGCTCTGG No data
939629286_939629303 29 Left 939629286 2:144514971-144514993 CCTCCCTCTCTGCCAGGTCTCCT No data
Right 939629303 2:144515023-144515045 ATTTCCTTAGACCTGGGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939629303 Original CRISPR ATTTCCTTAGACCTGGGCTC TGG Intronic