ID: 939633368 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:144551812-144551834 |
Sequence | AGTTATCTGCAGATGATGGC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
939633365_939633368 | 5 | Left | 939633365 | 2:144551784-144551806 | CCAAGGGCTCTCTCTCTCAAAGG | No data | ||
Right | 939633368 | 2:144551812-144551834 | AGTTATCTGCAGATGATGGCAGG | No data | ||||
939633364_939633368 | 14 | Left | 939633364 | 2:144551775-144551797 | CCTTTAAGGCCAAGGGCTCTCTC | No data | ||
Right | 939633368 | 2:144551812-144551834 | AGTTATCTGCAGATGATGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
939633368 | Original CRISPR | AGTTATCTGCAGATGATGGC AGG | Intergenic | ||
No off target data available for this crispr |