ID: 939633368

View in Genome Browser
Species Human (GRCh38)
Location 2:144551812-144551834
Sequence AGTTATCTGCAGATGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939633365_939633368 5 Left 939633365 2:144551784-144551806 CCAAGGGCTCTCTCTCTCAAAGG No data
Right 939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG No data
939633364_939633368 14 Left 939633364 2:144551775-144551797 CCTTTAAGGCCAAGGGCTCTCTC No data
Right 939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939633368 Original CRISPR AGTTATCTGCAGATGATGGC AGG Intergenic
No off target data available for this crispr