ID: 939639260

View in Genome Browser
Species Human (GRCh38)
Location 2:144619324-144619346
Sequence GTTGTATCTTGGGAGTTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939639255_939639260 14 Left 939639255 2:144619287-144619309 CCTATTTGTGGGAGCTTTTGTGT No data
Right 939639260 2:144619324-144619346 GTTGTATCTTGGGAGTTCAATGG No data
939639254_939639260 15 Left 939639254 2:144619286-144619308 CCCTATTTGTGGGAGCTTTTGTG No data
Right 939639260 2:144619324-144619346 GTTGTATCTTGGGAGTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939639260 Original CRISPR GTTGTATCTTGGGAGTTCAA TGG Intergenic
No off target data available for this crispr