ID: 939639851

View in Genome Browser
Species Human (GRCh38)
Location 2:144627342-144627364
Sequence TTCATGGACGTGCTCACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
939639851_939639859 24 Left 939639851 2:144627342-144627364 CCCACTGTGAGCACGTCCATGAA No data
Right 939639859 2:144627389-144627411 CCCTGGAATTTATATTTTGGTGG No data
939639851_939639854 7 Left 939639851 2:144627342-144627364 CCCACTGTGAGCACGTCCATGAA No data
Right 939639854 2:144627372-144627394 GAAAAAAACCTTTGTTCCCCTGG No data
939639851_939639856 21 Left 939639851 2:144627342-144627364 CCCACTGTGAGCACGTCCATGAA No data
Right 939639856 2:144627386-144627408 TTCCCCTGGAATTTATATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
939639851 Original CRISPR TTCATGGACGTGCTCACAGT GGG (reversed) Intergenic
No off target data available for this crispr